¿Viva Cristo Rey?

Leo anonadado la siguiente noticia. El Mundo:

Al grito de ‘Viva Cristo Rey’, tres individuos agredieron al actor y al autor de la obra ‘Me Cago en Dios’ y destrozaron la escenografía y el equipo técnico en la representación celebrada el sábado por la noche en el Círculo de Bellas Artes, apenas comenzada la función. El director del montaje, Pedro Forero, ha denunciado que, mientras eran retenidos en el baño a la espera de que llegara la policía, los tres asaltantes “comenzaron a rezar”. Asimismo, ha explicado que, según le ha contado el actor, Fernando Incera, éste permaneció oculto tras un biombo en el inicio de la obra, el cual fue derribado por uno de los individuos y tras lo cual empezó a recibir golpes. Según comentó, posteriormente, “lograron reducir a alguno mientras otro de los agresores, al parecer, intentaba destrozar la escenografía, “y lo consiguió”. Además, ha apuntado que los agresores probablemente pretendían quemar el escenario, compuesto de rollos de papel higiénico, aunque “afortunadamente no lo consiguieron”. (…)

Se ha abierto un vortex espacio-temporal y los neo-requetés han reaparecido para iniciar una nueva guerra santa en contra de los ateos.
Cuando se discutía la noticia del estreno de la obra de teatro “Me cago en Dios”, los sectores “liberales” pusieron como uno de los argumentos en su contra, que si en vez de Dios, fuera Alá, los “integristas” musulmanes ya habrían hecho algo (como intentar quemar la sala). Al parecer han tenido un error de cálculo, pero no se han equivocado con el resultado.
Parece que la ideas “libertad de expresión” y “democracia” pasaron sin dejar huella por los cerebros de estos neo-requetés.
¿Habrán ido a un colegio concertado?
Actualización, 03 Mayo:
Según El País, los agresores eran dos y no tres, y han resultado ser nietos de Blas Piñar. Cultura familiar.

You may also like...

314 Responses

  1. Corleone says:

    A nadie en su sano juicio se le ocurre hacer una obra llamada “Me cago en Alá” o “Me cago en los judíos de Auschwitz” o (esta sería mi favorita) “Me cago en la Generalitat Catalana y sus muertos de la Guerra Civil”. ¿Por qué? Porque eso sería una agresión peor que la agresión física. Sería un acto que en si mismo repudia la misma existencia de ese acuerdo general que llamamos civilización. La libertad de expresión existe en una democracia porque un demócrata debe saber especialmente donde termina y como se usa su propia, preciosa libertad. Cuando se toma la democracia como excusa para agredir al vecino, como bien lo ha hecho esa obra desde el título, se puede esperar cualquier cosa pues los autores han renunciado al mas básico de los respetos.
    Nerón, Domiciano, Hitler y Stalin se cagaron en Dios mientras pudieron. A tomar nota pues, que los actuales no van a acabar de distinta manera.
    V.C.

  2. Junjan says:

    Según esa filosofía de “censura democrática”, ¿empezamos a prohibir libros? ¿Quién decide donde termina la libertad de expresión? ¿Tú? ¿El gobierno? ¿El partido? ¿La Iglesia? ¿Qué es ofensivo y qué no?
    ¿Han cerrado acaso los juzgados? ¿Suspendieron las leyes? Si algo es tan ofensivo, ¿por qué no lo demandan?
    Por otra parte, tus ejemplos en mi opinión no son comparables, no es lo mismo cagarse en un concepto indemostrable, o en un personaje literario, que en personas o instituciones formadas por personas. Para mí cagarse en Dios es como cagarse en Papá Noel, o cagarse en Peter Pan, o en Tutatis y Belenos.

  3. Corleone says:

    Pues yo no sé si tienes madre pero no tengo ninguna razón para dejar de respetarla. No me parece que exista Manitú pero no me cago en el porque todos los hombres son mis hermanos y los indios que creen en Manitú también. Ahora si tu crees que cagarse en Dios es tu derecho constitucional, adelante y hazte el macho con el par de viejas que quedan en la sacristía. Menudas huevas tienes, ¿por qué no vas a la Meca y te cagas en Alá? R: Porque te van a romper el culo.
    Te cagas en los cristianos hoy porque sabes que no te pueden hacer nada. En tiempos de Don Fernando y Dña. Isabel te hubieras callado bien la boca. En suma: no piensas, no estimulas a nadie, no das nada. Solo eres hijo del rigor.
    El asunto es si Dios se caga en tí, menudo problema tienes si el Gran Tío está temporalmente escondido y aparece mañana con cagaderas y selecciona tu casa (y el teatro ese) para librarse de las divinas cacas. Me importa un pepino si eres ateo o no eres ateo. Una buena persona, o al menos, una persona con una mínima altura intelectual no se caga en nadie. Ahora hago mi excepción con los españoles que Francos, Pizarros y Corteses habéis producido como diarrea y ahora, que coméis todos los días, hasta Dios os parece demasiado chico. Ya os va a llegar la hambruna y otro peor que Franco y ahi veremos en quién os cagáis.

  4. Corleone says:

    Y viene al caso: ahora os cagáis en Franco pero nadie se cagó en él hasta que dejó de respirar.
    Tampoco os cagásteis en Bolivar o en San Martín (bueno os cagásteis un poco en la retirada de Boyacá que fue media desordenada, je je) y ni hablemos de Lord Nelson o de la valiente retirada de calzoncillos húmedos de hace unos meses en Irak… je je claro… es que hay que ser correcto. Huele mal el progre español, las cuentas no cierran y el frente de batalla mas bien parece un cementerio. Os atrevéis solamente con los muertos y los débiles como cualquier chulo de esquina.

  5. Junjan says:

    Veo que seguimos el argumento cansino de siempre. ¿Qué coño tiene que ver defender que alguien diga lo que quiera en España con ir a La Meca a cagarte en Alá?
    Yo no quiero que se cree un derecho a cagarse en Dios, ya existe. Es el derecho a difundir pensamientos, ideas y opiniones sin censura previa. Siento que en los Emiratos Arabes no exista, pero en España si. Quizás te guste más su sistema…
    Además, Dios no es una persona que esté protegida por su derecho al honor, Dios es un puto concepto sin demostrar y como cualquier concepto o teoría, en las sociedades donde existe el libre pensamiento, está sujeto a controversia.
    Ya se que debe de joder que cada uno pueda pensar y decir lo que le da la gana, ajo y agua.
    Tu no tienes ni puta idea de lo que yo habría hecho o dejado de hacer cuando Moctezuma era joven, ni yo tampoco, y además no viene a cuento. No tienes argumentos.
    Dios puede cagarse en mi todas las veces que le de la puta gana, e invoco a Dios, a la santísima trinidad, al cordero, al pez y a la puta paloma de los cojones a cagar toda la mierda que quieran en mi humilde persona.
    Veo que acusas mucho a los españoles de hacer y no hacer. Cuando te den el premio Nobel de la Paz, vuelves y nos das clases. Mientras tanto, cambiar de tema sin dar argumentos es sólo síntoma de ignorancia.

  6. corleone says:

    Veamos, ¿existe España? No está demostrado relamente. Me baso en Carod-Rovira y el ETA que se juegan a que España no existe sino como un concepto forzado. Me cago en España entonces y el Premio Nobel de la Paz se lo pueden meter por el culo sres. europeos y de paso los “ismos” que nos han inventado desde 1492 en adelante y por los que siempre terminan pagando los pobres. Te he demostrado que eres un cobarde no te cagas en todos los dioses, solo en aquellos que juzgas menos peligrosos. Pero la hora le llega a todo el mundo aun a los cobardes que se empeñan en matar al feto, al inmigrante, al tipo que va a la Iglesia. Bien quietos estábais con el tio Paco y la tomábais por el culo y hasta pedíais mas. Ahora que tenéis libertad os ensañáis con el débil y el tranquilo porque eso es lo que sóis: cobardes que solo conocen la ley de la masa rabiosa, ignorantes hasta la médula que solo creen las chorreras de la cadena SER y se mean con Serrat y otros capitalistas tapaos como él. Me alegra que me llames ignorante, es un sambenito que llevo con gusto, nunca he pisado una universidad: soy obrero, leo lo que quiero, creo lo que quiero y pienso lo que quiero: de punta a punta mi único Dios es la verdad.
    Cágate en eso si quieres, cobarde, lerdo de sesos y gilipollas.

  7. Pepa says:

    Ignorante no es un sanbenito … es una cruz.
    Nada mas deleznable que un currante de a cuarta de la época de Franco que se identifique con su opresor (un jodido dictador que pisoteaba todos sus derechos) y encima haga gala de ello.
    Nada mas deleznable que alguien que clame por el respeto de los demás para causas que le vienen grandes pero que, por pompa, hace propias y pierda los papeles hasta el punto del insulto y la pataleta.
    Nada mas deleznable que un “ignorante vocacional” (y aqui la universidad no pinta nada) que ante la falta absoluta de criterios opta por el descrédito y el encasillamiento perpetuos.
    Pero deleznable, repugnante e hitoricamente imperdonable es hacer leña de todos aquellos que (y cito)no se “dejaron encular por Franco” “ni pidieron mas” y que si se cagaron en el cuando era el “generalísimo”… todos los opositores … los exiliados … los asesinados …
    Machote, el español es un pueblo bravo … paciente pero bravo y en esos tiempos que tu dices … habia muchos que se atrevian a cagarse en Franco, a asegurar que “la única iglesia que ilumina, es la que arde” y a oponer digna resistencia a un régimen que se valia de gente como tu para exterminar a su oposición
    Respeto histórico merecen …

  8. corleone says:

    Pues ponte a quemar iglesias si quieres. Muchos cagatintas se han llenado la boca con eso y estan todos sin excepcion a un metro bajo tierra. Y la Iglesia sigue iluminando tan campante… mientras Napoleon, Stalin, Neron, Caligula, Domiciano, Hitler y la URSS son… comida de gusanos. Vociferas, pero la Historia grita mas fuerte.

  9. Pepa says:

    Ni un metro bajo tierra, ni comida por los gusanos … vivita, coleando y tirando de mucha gente … pese a ti.
    La historia, pone a cada uno en su sitio … debieras releerla, porque no la has entendido chatín y en cuanto a que la iglesia ilumina “tan campante”, o estas ejerciendo de eremita en lo alto de un monte o es que no te enteras de nada.
    ¡A propósito! vigila tus citas, que estas mezclando churras con merinas.
    Y por último, seria divertido que contestaras al quiz de la cuestión en lugar de desgallitarte insultando al personal.

  10. Everardo Segoviano says:

    Todo esta discusión me da risa de lo lindo. Vamos, que no está para más ver cómo se deschongan por el cada uno por su propia idea. Con esto del relativismo moral e ideológico cada quien pinta su mono según lo ve. Claro pues, desde que murió Dios, según Nietzsche, cada quien puede hacer lo que le venga en gana. Claro, necesitan el “concepto abstracto” bien muerto para que todo sea permitido. De esa manera, la democracia que no respeta más que la opinión de la mayoría, aunque ésta no sea la mejor ni la más sabia. El capitalismo hace de las suyas enriqueciendo más a unos y empobreciendo hasta la miseria a otros. El hedonismo deleitándose a su guto aunque para ello tenga que cosificar a la persona y terminar con la vida humana. Puros conceptos, pero muy reales y “vivitos y coleando” pero que arrastran a los unos y a los otros. Cada loco con su idea.
    Lo cierto es que hoy lo digno, noble, bueno, virtuoso, lo sublime, aquello que hace al hombre más y mejor ser humano, no llama la atención: Dios. Es un mero concepto si queréis, pero es un concepto por el que millones de personas han muerto a lo largo de 2000 años. Esas personas, las verdaderas, no los falsos que pretenden un Dios a su medida o un Dios muerto, esas personas fueron dignas, más humanas, forjaron un mundo mejor… no quiero pensar en otros conceptos, pero indudablemente también hacen de las suyas y si no… vean a su alrededor
    Ever

  11. Martha says:

    Pues sí, si de definir se trata lo que es la libertad de expresión y el respeto, sería en un marco humano, los seres humanos no somos animales para cagarnos en todo. La libertad y el respeto termina cuando se resta la de otros. Quién lo dice o lo determina? Nuestra propia conciencia. Si no la tienes, entonces puedes estar seguro que un día van a gritarte “Viva Cristo Rey”.

  12. david says:

    Junjan:
    Veo que defiendes la libertad de opinión, siempre que ésta sea en contra de Dios o Cristo.
    Pero, ¿Defiendes la libertad de expresión si alguien se le ocurre la idea de hacer una obra que diga “viva los seguidores de Hitler”?
    Según tú, esto sería igual de respetable.
    Y no se a que viene tanto afán por defender la libertad de pensamiento desde tu persona.
    A los que han ido defendiendo el concepto de Dios o la existencia histórica de Jesucristo en ésta página,tú los has tratado de imbéciles, cuando no censurado cerrando el foro.
    Tú mismo te contradices
    PD: La existencia y la inexistencia de Dios son indemostrables.

  13. federico says:

    viva Cristo REY

  14. Junjan says:

    Pequeño problema de tu razonamiento. Hitler fue una persona real que indujo a la muerte de millones de personas. Dios es un ser imaginario. Además, la apología del nazismo es delito en Europa.
    Pero una obra satírica y/o histórica sobre Hitler es perfectamente factible, aunque su título fuera “Viva Hitler”, por ej. “El Hundimiento”, gran película.
    Yo no he censurado nunca a nadie. Cerrar los comentarios después de más de un año no es censurar. Si quisiera censurarte simplemente bloquearía tu IP.
    Pero llevas camino, no de que te censure, sino de que no te conteste por aburrimiento ante tu ausencia de argumentos.

  15. david says:

    Junjan:
    Que tú no creas en Dios, no quiere decir que no exista (al igual que si yo creo en Dios, no quiere decir que exista).
    Insultar a Dios, decir que si crees en Él es signo de debilidad, yo lo considero un insulto.
    No creo que haya que recurrir a la violencia para protestar,es más, yo condeno eso,al igual que condeno los atentados en los cines que proyectaron “Jesucristo Superstar” de Tim Rice y “la última tentación de Cristo” de Scorsese.
    Hay muchas formas para hacerse escuchar.
    Te puedes expresar libremente, siempre que respetes los ideales que no hacen daño a nadie, como es creer en Dios.
    Creo que la Constitución de nuestro país pide que se respeten los ideales religiosos, por lo tanto, burlarse de Dios, y burlarse de millones de creyentes, es inconstitucional.
    Al menos, eso creo.
    En cuanto a ti, llamastes besugos a los creyentes al final de “Jesucristo no existió III”, creo que eso es insultar. (Corrigeme si me equivoco)

  16. Junjan says:

    Decir que el concepto de Dios es inofensivo y nunca ha hecho daño a nadie es realmente de una simpleza exagerada. En nombre de Dios se han cometido todos los crímenes imaginables y algunos inimaginables.
    Yo creo en la libertad de expresión y una prueba es que tu puedes escribir aquí lo que te de la gana.
    El “respeto” por los ideales religiosos no está en la constitución española, pero si en muchos países teocráticos. En la españa franquista era obligatorio…
    Los creyentes tienen todo el derecho a burlarse de los no creyentes, ¿por qué deberia ser distinto al contrario? Aunque no lo veas, tu postura conlleva siempre la superioridad de los creyentes sobre los ateos. No es verdad.
    Una “conversación de besugos” es una conversación que no lleva a ninguna parte. Si quisiera insultar no sería tan fino.

  17. david says:

    Junjan:
    De acuerdo contigo en que en el nombre de Dios o de la religión se han hecho las más grandes barbaridades, pero también las mejores.
    También se han hecho barbaridades en nombre de una filosofía como el marxismo o el nazismo.
    Yo no creo que los creyentes tengamos el derecho a burlarnos de nadie (sean o no creyentes).
    Creo que todos deberíamos amarnos y respetarnos al margen de nuestras creencias (por muy absurdas que nos parezcan)
    Si una persona cree en Dios, no sé porqué va a ser un ignorante o un fanático.
    Corrígeme si me equivoco, ¿si yo creo en Dios significa que soy ignorante y fanático? ¿Estás o no fomentando un estereotipo hacia nosotros?
    Un saludo

  18. Junjan says:

    Yo no se si te das cuenta de lo que estamos discutiendo. Estos son los comentarios de un determinado artículo donde da la casualidad que unos ignorates y fanáticos católicos se dedicaron a pegar a un actor y a destrozarle el escenario.
    ¿les estás defendiendo? ¿te sientes representado por ellos?

  19. david says:

    Junjan:
    Yo no me siento identificado con ninguno de esos católicos, ni tampoco con los que atentaron en los cines en que se proyectaban “Jesucristo Supestar” de Tim Rice y “la última tentación de Cristo” de Scorsese.
    Tampoco soy católico, pues mis padres no me bautizaron, ya que soy judío de nacimiento, ni tengo ningún vínculo con esta institución.
    Sin embargo, creo que se puede protestar por una obra que, por el título creo que fomenta la blasfemia, y sin recurrir a la violencia o al fanatismo.
    Mi pregunta era: ¿Por el simple hecho de creer en Dios soy fanático o ignorante?
    Espero tu respuesta
    Un saludo

  20. david says:

    Junjan:
    Que conste que yo NO DEFIENDO A NADIE que intente protestar por lo que sea empleando la violencia o el terrorismo.
    En ese sentido, estoy de tu parte.
    Un saludo

  21. neron says:

    La polémica que tenéis por ideas solo es una cuestión de LIBERTAD DE EXPRESION y,la libertad de expresión no tiene censura ni debe de tenerla. La responsabilidad unipersonal de cualquier esputo delictivo se dirime en los tribunales.Yo también me cago en la metafísica.

  22. calígula says:

    Bien por tí Nerón, eres libre.

  23. francisco says:

    porque diablos ofender las creencias de los demas? creo que el sentimiento religioso de las personas es algo digno de respetar, una cosa es la critica como por ejemplo que se señalen cosas negativas de la iglesia catolica, pero otra es que se ofendan simbolos y figuras relgiosas, la libertad de expresion termina donde comienza el irrespeto a los demas, el respeto al derecho ageno es la paz y siembra violencia y cosecharas mas violencia

  24. Colega says:

    A ver Junjan, voy a seguir tus palabras y a cagarme en toda tu puta familia y en el padre que no conoces y en la guarra de tu novia, que se enrolla con la portera de mi bloque.
    ¿Te gusta mi libertad de expresión, so hijo de mil padres maricones?

  25. la concha de tu vieja says:

    Colega… parece que estás mal… pero que muy mal follao… No te ofendas, es sólo libertad de expresión como la de vos…

  26. Walter says:

    Hola David:
    Después de tiempo volvi a curiosear por los comentarios de este blog (siempre leo los artículos de “Opinión Alternativa”, aunque no los comente)y me alegró encontrarte. Aprovecho para disculparme por no haber podido despedirme de tí cuando cerró el interesante JesNoExIII, me divertí mucho. (A veces extraño también las discusiones con Martha y Agapito, pero los temas terminan gastándose)
    Aunque no comparto tus forma de pensar -y sin animo de reiniciar la polémica- me parece muy bien que persistas en llevar tus opiniones a este foro, siempre se puede aprender algo intercambiando ideas.
    Un abrazo,
    Walter

  27. Eduardo Cruz says:

    NUEVA EVIDENCIA QUE EXIGE UN VEREDICTO
    ( tomado de los libros originales de: Josh Mc Dowell ;
    adaptado por: Lic. Eduardo Cruz )
    La sincera motivación de recopilar esta interesante información no es para entrar en polémicas de religión, teología, filosofía, doctrina o apologética; mucho menos para ganar discusiones; si no más bien dar una muy buena base para la fe cristiana.
    Y para comenzar pongámonos de acuerdo pues y comencemos con una buena
    ACTITUD IMPARCIAL; recordando que el propósito de un historiador serio no es reconstruir la historia basándose en nociones preconcebidas y ajustarlas a su agrado personal, sino más bien reproducir la historia a partir de la mejor evidencia y dejar que ella hable por sí misma; pues recordemos que: “un testigo veraz se muestra siempre natural y desdeña lo artificioso…” (significativas palabras del abogado Edward Clarke)
    *Josh McDowell comenta:
    Mi trabajo fue investigar evidencias bibliográficas, históricas y arqueológicas a pesar de los pro y los contra, yo por mi parte me había propuesto desacreditar el cristianismo, pues tenía preferencias y prejuicios en contra de Cristo, mas no a favor de Él; pero los resultados demostraron lo contrario de lo que yo estaba esperando comprobar y yo en base a esto tomé una decisión; y no hallé lo que quería encontrar, sino más bien confirmé mediante la investigación lo que deseaba refutar.
    Todo comenzó cuando todavía era alumno en el “Kellogg College” de Michigan y un grupo de estudiantes cristianos me exhortó a que examinara intelectualmente las afirmaciones del cristianismo.
    Yo estaba “seguro” (al menos por lo que creía saber) que el cristianismo no valía la pena; pero acepté el “desafío” y puse como primer punto a desacreditar “la resurrección de Cristo”; pero, vaya sorpresa, pues en su lugar encontré las pruebas de las evidencias más convincentes para la confiabilidad bibliográfica del Nuevo Testamento y la veracidad histórica de la Resurrección.
    *Escéptico o incrédulo:
    Uno no puede esperar hallar la verdad y al mismo tiempo estar pre-dispuesto a no aceptarla, por puro gusto personal, por prejuicio o por estar en desacuerdo con ella.
    Esto es lo que los hombres han hecho al rechazar como verídica la resurrección de Jesucristo, aún antes de comenzar siquiera una diligente investigación histórico-bibliográfica seria.
    Estas presuposiciones no tienen fundamentos, sino más bien son prejuicios filosóficos para auto-justificarse llamando “escepticismo” a su incredulidad y dureza de corazón.
    Bertrand Rusell (1872 – 1970 ) filosofo y matemático Británico, quien es uno de los precursores de la metafísica moderna; con todo y su gran nominación al premio novel, demostró toda su “sapiencia ” al declarar que:
    “Es históricamente bastante dudoso si Cristo realmente existió…
    …y si es que existió no sabemos nada acerca de Él”…
    él si que es un ejemplo de un “ateo inteligente”, al no tomarse siquiera la molestia de mirar el Nuevo Testamento al intentar refutarlo cuando escribió su ensayo: “Por qué no soy cristiano”…
    ..pero entonces… ¿quien es más borreeego?
    La ironia de la historia…
    Y en la opinión de Federico W. Nietzsche filosofo Alemán (1844-1900) (famoso autor de “aurora” ; “asi hablaba Zaratustra” ; “el anticristo” ; “el crepúsculo de los idolos” entre otros … y llego a declarar que:
    “la fe; significa no querer saber la verdad”… y bueno; Él pasó los últimos 12 años de su vida en total aletargamiento, soledad, ceguera y locura… y veamos como influencio con su “gran sabiduría” y a otro famoso enfermo mental que termino suicidandose en 1945; Adolfo Hitler
    Pero Según la carta de Pablo a los Hebreos (11:1) “la fe es la certeza de lo que se espera, la convicción de lo que no se ve” (no la emoción de lo que sí se ve); a diferencia lo que puede llamarse fábula, mitología (o mito), cuento, novela, leyenda o alguna extraña filosofía donde finalmente se apela más a las emociones que a la razón (ó a los hechos históricos reales); y es que en realidad no es tan importante la cantidad de fe que uno pudiera llegar a tener, sino en donde (o más bien en Quien) esta depositada; esto es lo que le da el verdadero valor.
    *¿ Pues no que muy “Open Mind” ?
    En una ocasión un brillante pero confuso psiquiatra me confeso con franqueza que nunca había estado dispuesto a “considerar” honestamente las fuertes aseveraciones de Jesucristo en su propia vida por temor a llegar a convencerse y por consecuencia sentirse comprometido a tener que cambiar su aparentemente cómoda y tradicional (pero a la vez vacía y necia) manera de “vivir”.
    *¿ Nos haría favor de ponerse de pie el verdadero “Sr. Excusa” ?
    Las excusas “intelectuales”; es que realmente no se trata de un “no puedo”, si no mas bien de un “no quiero”, puesto que la mayoría de la gente rechaza a Cristo por una o más razones:
    -Ignorancia.
    Con frecuencia auto-impuesta pues consideran los temas de Cristo y a la Biblia como una “aburrida” pérdida de su “valiosísimo” tiempo.
    -Orgullo.
    Profesando ser sabios, se hicieron necios… (Romanos 1:22).
    A un estudiante le pregunte: ¿Por qué no puedes tú creer?, él me respondió: el nuevo testamento no es digno de confianza, le pregunté entonces: Si yo te comprobara que el nuevo testamento es una de las piezas de literatura antigua más dignas de confianza, entonces tu ¿si estarías dispuesto a creer?… él inmediatamente replicó un rotundo NO; bueno entonces, tu no tienes un problema en tu mente, sino mas bien en tu voluntad, le respondí: porque a pesar que yo te pudiera demostrar la evidencia bibliográfica que respalda la confiabilidad histórica del Nuevo Testamento, tu como quiera no vas a querer creer aunque insisto (si podrías hacerlo).
    -Problema moral.
    Una estudiante quería creer y hacer creer a otros que el cristianismo “no era histórico y que no estaba avalado por los hechos”. En su clase intentó convencer a todos sus compañeros de lo mismo; pero después de algunas preguntas que yo le hice, (comenta McDowell) ella admitió haber engañado a todos y dijo haber inventado estas “dudas intelectuales” con el fin de excusar su vida moral…
    ¡ups! la verdad no peca… (pero como incomoda)
    ..Vamos; si la Biblia es otro “libro” más ¿o no?
    Un hombre “inteligente” que realmente ande en busca de la verdad ciertamente leería y consideraría un libro que tiene las cualidades ÚNICAS con las que cuenta la Biblia; estas singulares características están basadas en los hechos y están apoyadas por la historia.
    La veracidad de la Escritura está confirmada por descubrimientos arqueológicos específicos y documentados; y existen testimonios de escépticos que han visto radicalmente cambiadas sus actitudes hacia la Biblia como resultado de la investigación arqueológica.
    *He aquí como ejemplo de la confiabilidad histórica del Nuevo Testamento Unger nos dice que:
    “la confiabilidad de Lucas… (autor de el evangelio con su nombre y el libro de los “Hechos” y quien por cierto era doctor)… como historiador es incuestionable porque involucró la labor de un cuidadoso historiador, que se mostró substancialmente en el uso de fuentes confiables de documentación”…
    Sir William Ramsay (considerado uno de los más grandes arqueólogos que han existido) comenta que: “Lucas es un historiador de primera categoría por que fue muy detallista en su narración demostrando una veracidad maravillosa… en resumen: este autor debería estar colocado (o considerado) entre los más grandes historiadores del primer siglo”…
    El Prof. Monticio-Williams (ex profesor de Sánscrito) quien pasó 42 años estudiando los grandes libros del oriente y al compararlos con la Biblia concluyo diciendo: “Hay un gran abismo entre ella y los “Libros Sagrados” del oriente; un abismo tan profundo de diferencia que no puede ser atravesado por ninguna ciencia o pensamiento filosófico o religioso”.
    *Y para el libro de “record guiness”… (¡CHECATE ESTO!)
    He aquí la singularidad de la Biblia antes mencionada:
    *Escrita en un periodo de 1,600 años aprox.
    *Escrita a lo largo de 60 generaciones.
    *Escrita por más de 40 autores de todas clases sociales (médicos, pescadores,
    militares, reyes, pastores, etc…)
    *Escrita en 3 idiomas:
    -Hebreo: Antiguo Testamento. Lengua de Judá y Canaan.
    -Arameo:“lingua franca” del cercano oriente hasta el tiempo de Alejandro “el grande” (siglo 6 a.C., hasta el 4 a.C.)
    -Griego: era el idioma oficial del Nuevo Testamento, internacional en los tiempos de Cristo.
    *Escrita en 3 continentes:
    -Asia, África y Europa: (Por lo tanto en diferentes países)
    *La Biblia ha sido única en su circulación, ha sido leída por más gente y publicada en más idiomas que cualquier otro libro. Se han producido más copias de ella que de cualquier otro libro en la historia; y por sobre todo no hay absolutamente ningún otro libro que alcance o comience siquiera a comparársele en su circulación, por ejemplo:
    -El primer libro formal que se publicó fue la versión Vulgata Latina en la prensa de Gutenberg.
    -El telegrama más largo que registra la historia fue la Versión Revisada del Nuevo Testamento, enviado desde Nueva York a Chicago.
    *La Biblia es única en su supervivencia, a través del tiempo, la persecución y la crítica; y como un ejemplo, Sydney Collett comenta:
    Voltairé, (Francois Marie Arouet 1694-1778) el destacado pensador-filosofo e incrédulo francés que declaro que en 100 años después de su muerte la Biblia y el cristianismo serían borrados y pasarían a la historia, e irónicamente solamente 50 años después de su muerte, la sociedad Bíblica de Génova uso la misma prensa y la casa de él para producir montones de Bíblias.
    ¡He ahí la jactancia de Voltairé!
    Ja, ja, ja;… ¿qué?… ¿Cristo? …
    ! eso es puro cuento !
    A algunos “escritores” les gusta divertirse con la idea de propagar la teoría de un “mito-Cristo” (la cual afirma que ni siquiera existió “tal” ), pero no lo hacen sobre una base de la evidencia histórica, puesto que no son los historiadores los que promueven esta teoría.
    Otto Betz afirma acertadamente: “Ningún erudito serio se ha atrevido a postular la no-historicidad de Jesús”…
    Siendo objetivos y aunque se rechazara la Biblia como “histórica”, esto no significa rechazar toda la evidencia documental existente; como ya hemos visto por medio de los registros histórico-bibliográficos que también existen (aparte de los 27 diferentes documentos cristianos) otras fuentes no bíblicas de antigua documentación (a favor y en contra de Jesús y del cristianismo) de origen samaritano, judío, romano y “gentil” que los eruditos han encontrado y que nos pueden confirmar la existencia y muerte de Jesús como verdadera e histórica; por citar algunos por ejemplo están:
    01. – Cornelio Tácito: Historiador ROMANO (aprox. 52 – 120 d.C.)
    02. – Luciano de Samosata: Satiro GRIEGO (segundo siglo)
    03. – Suetonio: Historiador ROMANO (año 120)
    04. – Plinio Segundo: “el menor” o “el joven”: Gobernador de Bitinia (año 112)
    05. – Talos : (año 52 aprox.)
    06. – Flegón:
    07. – Mara Bar-Serapio: SIRIO Estoico (escribió después del año 73)
    08. – Talmudes Judíos: babilonicos (entre 100 a 500 d.C)
    09. – Tertuliano: (160-220)
    10. – Flavio Joséfo (ben Matatias): (año 37)
    11. – Clemente de Roma:
    12. – Ignacio:
    13. – Quadrato:
    14. – Arístides:
    15. – Justino Mártir: (100-165)
    16. – Trajano:
    17. – Adriano:
    18. – Antonino Pío:
    19. – Marco Aurelio:
    20. – Juvenal:
    21. – Séneca:
    22. – Hiérocles:
    …entre otros y es que…aún la historia secular afirma que Jesús vivió en la tierra, que fue adorado como Dios, fundando una iglesia que ha durado más de 1,900 años, y que fue tal su impacto sobre este planeta que cambió el curso del mundo dividiendo en 2 la historia universal: a.C. y d.C. ; ahora bien, entonces la pregunta sería:
    ¿Cómo es posible que un sencillo carpintero judío, un hombre “común” de solo 33 años y tan solo 3 (aprox.) de vida publica que no recorrió mas de 3000 Km. a la redonda haya podido cambiar el curso de la historia del mundo siendo el único parte-aguas de la misma?…
    El historiador Phillip Schaff lo resume de la siguiente manera:
    “Este Jesús de Nazareth sin dinero ni armas, conquistó a más millones que Alejandro, Cicerón, Julio César, Buda, Mahoma, y Napoleón juntos; sin ciencia y sin erudición derramó más luz sobre las cosas divinas y humanas que todos los filósofos y eruditos combinados (incluidos los griegos); sin la elocuencia de las escuelas habló tales palabras de vida como nunca antes o después fueron dichas y produjo efectos más allá del alcance de cualquier orador o poeta; sin escribir ni una sola línea puso en movimiento más plumas a favor y en contra de Él e inspiró para más temas de sermones, oraciones, discusiones y obras de arte que él ejercito completo de grandes hombres de todos los tiempos antiguos y modernos”.
    *He aquí un “genio” para comprender a los hombres; Napoleón Bonaparte (1769 -1821) llamado “El Gran Corzo” y en su opinión sobre Jesucristo escribe:
    “Conozco a los hombres, y puedo decirles que Jesucristo no es meramente un hombre. Las mentes superficiales ven un parecido entre Cristo y los “fundadores de imperios” o los “dioses” de algunas religiones; este no es el caso puesto que tal parecido no existe.
    Entre el cristianismo y cualquier otra filosofía existe una distancia infinita.
    Todo lo referente a Cristo me asombra, su espíritu me anonada, su voluntad me confunde; entre Él y cualquier otro personaje de la historia del mundo no hay un solo término posible de comparación.
    Ciertamente Alejandro, Cesar, Carlomagno y yo hemos fundado imperios pero… ¿sobre qué descansa las creaciones de nuestro genio?…
    sobre la fuerza;… y sin embargo Jesucristo fundó su imperio sobre el Amor y estoy seguro que aun en esta misma hora millones de personas (de todas clases sociales y edades; voluntaria y gustosamente) darían su vida hasta la muerte por Èl el día de hoy.
    Solamente Cristo ha llegado a tener tal éxito… ante las barreras del tiempo y del espacio, a través del intervalo abismal de mil ochocientos años.
    Jesucristo solicita lo que la filosofía puede a menudo buscar en vano: el corazón del hombre; e incondicionalmente su demanda es satisfecha sin tardanza.
    Todo aquel que cree sinceramente en Él, experimenta ese Amor “sobrenatural” hacia Él; este fenómeno es indescriptible pues esta más allá de la comprensión del hombre.
    El tiempo, que es el gran destructor, no puede (no ha podido, ni podrá) agotar su fuerza ni tampoco poner un limite a su alcance.
    La naturaleza de la existencia de Cristo es misteriosa, debo admitirlo, pero este misterio satisface las necesidades más intimas del hombre, por lo tanto si se le rechaza, el mundo es un enigma inexplicable; mas si se le cree, la historia de la raza humana en el mundo es explicada satisfactoriamente.
    Él ciertamente es “Un Ser Único”, sus ideas y sentimientos; la verdad que anuncia y su manera de convencer no pueden ser explicadas por alguna organización humana, ni por la naturaleza de las cosas; su mensaje es la revelación de una inteligencia que ciertamente no es la de un hombre mortal, y en ninguna otra parte puede uno hallar
    ( excepto en Él ) tal ejemplo de vida.
    Escudriño en vano en la historia para hallar alguien parecido a Jesucristo o algo que se pueda aproximar al evangelio, pero ni la historia, ni la humanidad, ni las edades, ni la naturaleza me ofrecen algo con lo cual yo pueda compararlo o explicarlo… ¡Aquí todo es extraordinario!”…
    y para LOS PREMIOS DE LA ACADEMIA:
    …si realmente Jesús no era “DIOS”…
    entonces ¡se merece un OSCAR!
    Jesús (categórica, literal y deliberadamente) declaro ser Dios.
    No dejo abierta otra “posibilidad” con respecto a su persona, identidad, propósito y misión; (de eso no queda la menor duda pues esto le llevo a su propio juicio) por lo tanto seria una necedad sostener la idea de que solo fue un “Gran Maestro”, un “ILUMINADO” (o un “Avatar”); no, él no quiso dejar esa impresión; es más, le importaba mucho la opinión sincera de la gente con respecto a su identidad.
    Ahora bien, lo sorprendente de todo esto es que dijo sus “osadas” aseveraciones en medio de una cultura “celosamente monoteísta” y en medio de una generación “incorregiblemente religiosa” (desafiando así todas sus tradiciones y prejuicios); y no conforme con esto, se atrevió a decir que para demostrarlo: él mismo vencería la muerte al tercer día…
    ¡NINGÚN OTRO PERSONAJE TRASCENDENTE EN TODA LA HISTORIA DEL MUNDO SEATREVIÓO A DECIR ALGO SEMEJANTE SOBRE SÍ MISMO!… y para colmo hasta la fecha nadie ha podido demostrar lo contrario (ni tampoco nadie lo ha podido negar).
    Contrariamente a lo que se podría deducir, “la indubitable evidencia de la resurrección de Jesucristo de entre los muertos: jamás ha sido vencida.”
    *JESUCRISTO… ¿“Súper-Star” o “Súper-Savior”?
    “El cristianismo debe de ser histórico, puesto que afirma que Dios corrió el riesgo de involucrarse en la historia humana en la persona de Jesucristo y… efectivamente, ahí están los hechos para que sean examinados con el mayor rigor posible; finalmente soportaran cualquier cantidad de investigación critica”… ( significativas palabras de Michael Green )
    Pero… ¿para que se habría de involucrar en el curso de nuestra historia del mundo el Creador de todas las cosas? (Juan 3.16)…
    *Ahora bien; si en verdad “DIOS” se hizo “HOMBRE”,
    entonces esperaríamos que:
    01) Su Llegada al mundo (o “Aparición”) fuera anunciada con anticipación cronológica.
    02) Hiciera su entrada a este planeta de una forma diferente.
    (Isaías 7:14, Mateo 1:23)
    03) Fuera perfecto (sin pecado, Juan 8:46).
    04) Manifestara lo sobrenatural en forma de milagros. (Juan 11:39-44).
    05) Tuviera un agudo sentido de diferencia con respecto a otros hombres.
    (Mateo 7:28-29).
    06) Hablara las más grandes palabras que jamás se hayan hablado.
    (Lucas 21:33, Juan 7:46).
    07) Revelara con certeza las cosas pasadas y futuras
    (hasta ahora desconocidas para el hombre) con respecto del mundo, de su generación y de sí mismo.
    08) Satisficiera el hambre espiritual en el hombre. (Juan 11.25-27 y 6.35).
    09) Tuviera una influencia duradera y universal tiempo-espacio en la historia
    (a. C.- d. C).
    10) Finalmente ejercitara poder aún sobre la muerte; (Juan 11.43-44, Juan 20, Lucas 24, Mateo 28 y Marcos 16)
    demostrando así que todo lo que dijo realmente… ¡ era la verdad !
    *Casualidad o “Dios-idencia”
    A Jesús se le atribuyen el cumplimiento de las más de 300 profecías mesiánicas judías escritas en el antiguo testamento.
    Lo mas sorprendente de esto es que tan solo 29 de estas profecías tuvieron su cumplimiento literal en la persona de Jesús de Nazareth en un transcurso de 24 horas; aunque fueron escritas en un transcurso de 5 siglos desde aprox. 1000 años antes del nacimiento de Jesús;..
    ¡hey! tranquilo; cualquier escéptico (sincero y honesto) judío buscador de la verdad, puede hallar que, cualquier objeción tiene la única respuesta lógica en que Jesús es el Cristo-Mesías, el único Salvador del mundo.
    *A ver, a ver, entonces… ¿ no todos son “El Mismo” ?
    Ningún líder reconocido (Abraham, Moisés, Pablo, Buda, Mahoma, o Confucio) jamás se llegó a atrever auto-declararse o proclamarse como Dios o una “divinidad”; esto con la excepción de Jesucristo, (y esta declaración lo llevo a su propia muerte) pero también es el único que ha logrado
    convencer a una gran porción de la humanidad a través del tiempo
    y del espacio de que esto es cierto.
    Ahora bien; todas las religiones del mundo están basadas en meras presuposiciones filosóficas excepto 4 que se basan en personalidades, sin embargo ninguna se ha atrevido a reclamar el tener VIVO a su fundador excepto EL CRISTIANISMO, (si es que se le puede llamar religión puesto que Él fundó una iglesia no una religión).
    Aparte de Jesús estas son las otras 3 personalidades antes mencionadas:
    *Abraham: (antes Abram) quien es considerado como “El padre del judaísmo” murió aprox.1900 a.C. ; sin embargo ni en el “Thalmud” o en la “Torah” jamás se ha declarado que él haya resucitado, así como todos los demás patriarcas, reyes y profetas judíos como Moisés ó Elías
    *Buda: que significa el “iluminado” aunque su verdadero nombre era Siddharta Gautama pero según los relatos originales del “Mahaparinibbana Sutta”, nunca le atribuyen algo semejante a una resurrección. Nació en la India en Kapilavastu (563 a.C.) y murió en Kusinara (483 a.C.)
    *Mahoma: quien murió el 8 de junio del año 632 d.C. a la edad de 61 años en Medina donde su tumba es visitada anualmente por millares de fieles mahometanos devotos; y efectivamente no encontremos en las escrituras “Pali” que “Sakya Muni” haya existido después de su muerte o que se haya aparecido vivo a sus discípulos después de esta fecha.
    Finalmente todos los millones de judíos, budistas y mahometanos estarán de acuerdo al menos en una cosa: que sus fundadores finalmente nunca se han levantado del polvo de la tierra en resurrección.
    Y en la opinión de otros eruditos…
    * J. M. D: …”hay una gran improbabilidad de que el relato de la resurrección presentado en los evangelios (que por cierto concuerdan circunstancialmente) sea pura invención. Esta “teoría mítica” tiene que ser abandonada, pues no soportará el escrutinio estrecho”…
    * Michael Green: “El cristianismo cae o sigue de pie en base a la resurrección de su fundador : Jesús llamado también El Cristo y aun la historia universal es inconcebible sin ÉL”…
    * Goethe: (otro escéptico) que en los últimos años de su vida, termino confesando: “si alguna vez la “Divinidad” se apareció sobre este planeta, definitivamente fue en la Persona de Jesucristo”…
    * Kevan: “La iglesia (verdadera) es demasiado real para tener un fundamento mitológico”…
    * Ambrosio Fleming: asegura que: “la Iglesia Cristiana no esta fundamentada sobre ficciones o nutrida en base a engaños ( o como las llama San Pedro “fábulas artificiosas” ) sino mas bien sobre eventos históricos y verídicos, y los que aun cuando pudieran parecer muy extraños, son ciertamente los más grandes eventos ocurridos en la historia de la humanidad”…
    * Edward Clarke: comenta que: “La evidencia de la resurrección presentada en los evangelios se puede aceptar sin reservas como el testimonio de hombres veraces de hechos que ellos (presenciaron como testigos oculares y que) podían confirmar… y en calidad de abogado he hecho un prolongado estudio de las evidencias y para mí la evidencia es conclusiva”…
    * Lord Darling: (Ex juez Supremo de Inglaterra) dijo:
    “Si todo (como cristianos) tuviésemos que aceptarlo en base a la fe, yo por mi parte seria el primer escéptico; pero en el hecho de la resurrección de Jesús no se nos pide meramente que tengamos fe … ahora bien; el punto crucial de la personalidad de Jesucristo debe depender seguramente de su resurrección…
    ( con respecto de “La Personalidad” que el reclamo Ser… ¿Quien?:
    pues “El Dios Eterno hecho hombre” );… pero a su favor encontramos que existe una evidencia tan aplastante, positiva, factible y circunstancial, que ningún jurado “inteligente” del mundo dejaría de expresar el veredicto de que: la resurrección de Jesucristo de entre los muertos es verídica e histórica”…
    * El Dr. A. C. Ivy: (fisiólogo) comenta:
    “Yo creo en la resurrección física-corporal de Jesucristo;…
    y sobre la base de la evidencia histórica del conocimiento biológico existente:
    el científico leal a la “filosofía de la ciencia” podría poner en duda el fenómeno de la resurrección (física-corporal del Jesús histórico) pero no puede negarlo, pues al hacerlo estaría dando a entender que puede probar que no ocurrió tal acontecimiento… y tratar de negar la resurrección por puro prejuicio ¿no seria esto mas bien manifestar una actitud “anti-científica?”…
    * Thomas Arnold: (Profesor y famoso decano de Rugby designado para la cátedra de Historia Moderna en Oxford) comenta que:
    “La evidencia de la vida, muerte y resurrección de nuestro Señor Jesucristo puede probarse… y no sé de otro hecho en la historia de la humanidad que este comprobado por una evidencia mejor y más amplia… de que efectivamente: Jesucristo nació, vivió, murió y se volvió a levantar de entre los muertos”…
    R. M. Cheyne Edgar escribió: “He aquí un Maestro… que con toda calma declara arriesgar todas sus afirmaciones sobre su habilidad (después de haber pasado por la muerte) de levantarse otra vez de su tumba. Podemos declarar con confianza que nunca (antes o después) se ha hecho una proposición semejante. El que estuvo dispuesto a arriesgarlo todo en su habilidad para vencer la muerte, permanece ante nosotros como el mas original de todos los maestros; ¡uno que brilla con la luz de su propia vida!”…
    Una gran autoridad legal: Jonh Singleton Copley mejor conocido como Lord Lyndhurst (1772-1863) quien murió el 11 de octubre de 1863 a al edad de 91 años escribió: “Sé perfectamente bien lo que significa la palabra “evidencia” y les puedo asegurar que la evidencia que comprueba la resurrección de Jesucristo (de entre los muertos), jamás ha sido (ni podrá ser) vencida”… después de su muerte se halló esta declaración en un documento de su puño y letra en su despacho (en una gaveta de su escritorio) entre sus papeles privados.
    ¡Ah! … no se preocupen;… ¡ya otros lo han intentado!…
    Muchos estudiantes imparciales que han examinado históricamente la resurrección de Jesucristo, (que es la base de la fe cristiana) con el mas riguroso “espíritu critico”, y finalmente han sido confrontados por el peso de la evidencia de una diligente investigación bibliográfica e histórica, terminando por corroborar tal evento como un verdadero hecho histórico.
    * Un brillante joven abogado y periodista ingles llamado Frank Morrison (que creció en un “ambiente racionalista” y quien había llegado a tener la firme opinión de que la resurrección no era más que “un cuento de fantasía con un final feliz” )… hizo planes para escribir un libro sobre ”los últimos días de Jesús”; en donde omitiría (por supuesto), la mas mínima sospecha de todo lo que pudiera parecer “sobrenatural”, y así finalmente descartar del todo aquella
    “errónea fantasía de la resurrección”.
    Era un hombre sincero y al ponerse a estudiar los hechos con un extremoso y diligente cuidado e imparcialidad, y comenzando con el enfoque más crítico posible a los documentos del nuevo testamento encontró que: contrariamente al propósito original por el cual Frank había planeado escribir tuvo que rectificar su posición y finalmente escribió su libro, llamando significativamente al primer capitulo: “El libro que rehusó ser escrito” …
    y para “colmo” a su libro: “¿Quién movió la piedra?”…
    ¡Termino siendo un libro apasionante que resulta fascinador por la forma en que apela a la razón y una obra erudita que destaca con claridad la verdad de la resurrección!
    Esta es la fascinante obra de un hombre que se dispuso a demostrar que la historia de la resurrección de Cristo no era mas que un mito… sin embargo sus investigaciones le llevaron a ¡convertirse en un cristiano ferviente!
    * Gilberto West y Lord Lyttleton eran dos talentosos jóvenes que fueron a Oxford y estaban determinados a atacar la misma base de la fe cristiana.
    Por su parte Lyttleton se propuso investigar sobre la vida de Saulo de Tarso (el apóstol Pablo) para demostrar que nunca se había convertido al cristianismo. West por su parte, intento demostrar que “el mito” de la resurrección de Jesús era falsa.
    Algún tiempo mas tarde, se reunieron para discutir sus hallazgos; ambos estaban algo avergonzados porque aun en diferentes caminos y por separado habían llegado a las mismas “abrumadoras” conclusiones:
    -Littleton; tras investigar descubrió que: “Saulo de Tarso” llego a ser un hombre radicalmente nuevo y diferente mediante su conversión al cristianismo…
    -West; concluyó que la evidencia señalaba inequívocamente a favor del hecho de que: verdaderamente Jesús se levantó de su tumba…
    Su libro se titula:
    “Observaciones sobre la Historia y Evidencias de la Resurrección de
    Jesucristo”
    y fue publicado en 1747.
    *El que calla otorga…
    “El silencio de los enemigos de Jesús ( tanto judíos como romanos de aquella generación sobre aquella tumba vacía ) es una prueba elocuente de que la resurrección EFECTIVAMENTE se llevo a cabo, pues habla aun más fuerte que la voz y el testimonio de los cristianos”.
    -Reencarnación o RESURRECCIÓN-
    En una ocasión un estudiante de la Universidad de Uruguay me pregunto: ¿Por qué no puede usted Prof. McDowell refutar el cristianismo y la Biblia?; y yo le respondí: Por la sencilla razón de que no estamos en condiciones de negar un evento histórico: la resurrección de Jesucristo…
    sin embargo, si alguien me PUEDE demostrar que Cristo no se levantó de entre los muertos, yo no tengo derecho a seguir manteniendo mi fe cristiana…
    ni mucho menos de hablar de ella, pues es en la resurrección donde basamos nuestra fe. (1 Corintios 15. 14 al 19)
    ¡ESTO VA EN SERIO!
    Se emplearon aproximadamente 5000 “hombres-hora” basados en fuentes
    primarias y bibliográficas de documentación seria con mas de 1300 diferentes referencias de modo que los resultados fueran cuidadosamente dignos de confianza; además de un equipo de estudiantes de diferentes universidades.
    Finalmente después de más de 700 horas de estudiar concienzudamente este tema podemos llegar a la conclusión de que la base de la fe cristiana (que es la resurrección); “o es el fraude más perverso y cruel que se halla planeado para anidarse engañosamente en el corazón de los hombres, o es el hecho histórico más fantástico que jamás se halla llevado a cabo”.
    He aquí el registro completo ( como escribió G. B. Ardy) :
    Sepulcro de Confucio – – – – – – Ocupado
    Sepulcro de Buda – – – – – – Ocupado
    Sepulcro de Mahoma – – – – – – Ocupado
    Sepulcro de Jesús – – – – – – VACIO…
    He aquí las falsas teorías urdidas para refutar la resurrección:
    “La Teoría y el Veredicto”:
    1. La teoría del robo. ( Del cuerpo de Jesús ) Imposible e insuficiente.
    2. La teoría del desmayo. ( Del cuerpo de Jesús ) Imposible.
    3. La teoría de la alucinación. ( De los discípulos ) Un disparate.
    4. La teoría de la equivocación. ( De la tumba ) Ingeniosa pero insuficiente.
    5. La teoría de la incineración (Del cuerpo de Jesús ) Ingeniosa pero imposible.
    6. La teoría de la falsedad del relato ( De la resurrección de Jesucristo )
    y que éste (el relato) fue una “añadidura posterior” …
    ¡No soporta el escrutinio estrecho!
    7. La EVIDENCIA (de la RESURRECCIÓN DE JESÚS)… Elocuente.
    ( ¡Todas las teorías quedan totalmente refutadas! )
    A ti te corresponde decidir, sin embargo la evidencia habla por sí misma, diciéndonos muy claramente que:
    JESUCRISTO HA RESUCITADO EN VERDAD.
    ¡ La evidencia es abrumadoramente conclusiva !
    Notas sobre el autor:
    Josh Mc Dowell es autor de más de 45 libros
    entre los más populares hallamos :
    “Evidencia que Exige un Veredicto 1 y 2”,
    ( “Nueva Evidencia que Demanda un Veredicto” )
    “Razones”,
    “Convicciones mas que Creencias”,
    “Respuestas sencillas a preguntas difíciles”,
    “No dejes tu cerebro en la puerta”,
    “Mas que un carpintero” … entre otros.
    Considerado un “evangelista intelectual” llegando al corazón por medio del intelecto; escribió este libro de recopilación en base a una vasta obra de investigación sistemática.
    En las últimas décadas ha viajado en más de 80 países y ha dado conferencias en por lo menos en 700 universidades.
    “Este simplemente es el resumen de un libro que impacto mi vida, y claro, nunca va a sustituir a la Biblia, la palabra de Dios; pero ha reforzado mi fe en ella, en la iglesia cristiana, pero sobre todo en la deidad de
    Jesucristo y simplemente mi objetivo fue recopilar lo más importante e interesante para compartir de una manera diferente a los que no conocen a Jesucristo como su único y suficiente Salvador y Señor de sus vidas”.
    Lic. Eduardo Cruz

  28. Walter says:

    Hola Eduardo:
    Tu extensísimo panegírico apologético esta regado por muchos foros de la red y me parece de muy mal gusto que lo copies aqui al estilo de los correos en cadena. No obstante, con la venia del anfitrion de este blog (que debe estar hasta el cuello con el tema), te comento algo sobre el fondo del asunto:
    Es ilógico que hables de imparcialidad cuando partes de tu creencia en la biblia y sus cuentos sobrenaturales. Tu puedes creerlos pero muchos no, así que no hay imparcialidad, partes de la posicion dogmatica de tu fe.
    Tampoco es cierto que te bases en hechos historicos pues la Biblia no es un libro de historia, Tampoco puedes hablar de historia cuando citas in extenso a un escritor que NO ES HISTORIADOR sino un Ministro Evangelico especializado en Apologetica, como Josh Mcdowell (Puedes verificarlo en http://www.josh.org/apologetics)
    Su librito “Evidencias ..” ha sido refutado en detalle pero lamentablemente no he encontrado las versiones en castellano para copiarlas y pegarlas aquí como tu haces. En todo caso si quieres ilustrarte puedes encontrarlas en http://www.infidels.org/library/modern/jeff_lowder/jury/ (Si sabes ingles y el nombre de la web no te predispone)
    En cuanto a tus aburridísimas citas de personajes diversos, y a tus irrelevantes y falaces seudo argumentaciones de caracter esotérico; no prueban nada, salvo tal vez, como dijera alguien, que McDowell es un tonto.
    También me parece ridículo que creas que la palabra de un fanatico religioso como McDowell tenga autoridad para descalificar a un pensador de la talla de Sir Bertrand Russell; hay un abismo de diferencia entre ellos; y es absurdamente insultante que hables a continuacion de “borregos”. ¿Te refieres a Russell, o haces una inconciente confesión de parte?
    Hay muchisimos historiadores verdaderos y eruditos bíblicos realmente imparciales que han estudiado la Biblia, y la época en que supuestamente vivio Jesucristo, concluyendo en que NO HAY PRUEBAS DE QUE HAYA EXISTIDO y que el Nuevo Testamento carece de veracidad histórica.
    Termino en tu propio estilo, transcribiendo de otro foro:
    “Acerca de ese período de tiempo (siglo I) hay suficientes escritores que han dejado una cantidad de manuscritos donde se describen eventos de toda índole, pero con una peculiar excepción… no mencionan al “Jesús del NT”.
    John E. Remsburg, en su libro clásico El Cristo: una Revisión y Análisis Críticos de la Evidencia de Su Existencia (Empresa el Buscador de la Verdad, Nueva York, pp. 24-25), pone en una lista a los escritores siguientes quien vivieron durante el tiempo, o dentro de un siglo después del tiempo en que, se supone, ha vivido Jesús:
    Josephus, Philo-Judæ, Seneca, Pliny Elder, Arrian, Petronius, Dion Pruseus, Paterculus, Suetonius, Juvenal, Marcial, Persius, Plutarco, Pliny Younger, Tacitus, Justus de Tiberius, Apollonius, Quintilian, Lucanus, Epictetus, Hermogones, Silius Italicus, Statius, Ptolemeo, Appian, Phlegon, Phæ Drus, Valerius Maximus, Lucian, Pausanias, Florus Lucius, Quintius Curtius, Aulus Gellius, Dio Chrysostom, Columella, Valerius Flaccus, Damis, Favorinus, Lysias
    Pomponius, Mela, Appion de Alexandría, Theon de Smyrna.
    Según Remsburg, “Bastante de las escrituras de los autores nombrados en la lista precedente permanecen para formar una biblioteca. Aún en esta masa de literatura judía y pagana, aparte de dos pasajes falsificados en los trabajos de un autor judío, y dos pasajes discutidos en los trabajos de escritores romanos, no se encuentra ninguna mención de Jesucristo. “Ni, podemos agregar, cualesquiera de estos autores hacen la nota de los Discípulos o Apóstoles – aumentando de la vergüenza del silencio de la historia acerca de la fundación de cristianismo.”
    ¿Por qué no ha sobrevivido ningún manuscrito que mencione al “Jesús del NT” y se refiera a lo ocurrido entre los años del 30 al 40… pese a la cantidad de escritores que podrían haberlo mencionado…?”
    Atentamente
    Walter

  29. Junjanº says:

    Nada que añadir a lo dicho por Walter.
    Hay muy poco que entender, pero claro, es muy crudo para pollinos de tu calibre Eduardo Cruz (o como quiera que te llames): La biblia es una novela, el nuevo testamento y sus evangelios son novelas, lo escrito sobre ello son “novelas-sobre-novela”, no hay pruebas históricas de la existencia de la mayoría de sus personajes, el personaje llamado Jesucristo es más que probable que no haya existido y por lo tanto discutir sobre si resucitó es un auténtido disparate.
    Como diría un amigo, el único consejo que puedo darte es: “Get a life!”.

  30. YO says:

    Que se joda el circulo de bellas artes. q pena q no ardiera con todos los que fueron a ver esa blasfemia!!

  31. Walter says:

    El tal “YO” es al menos sincero en expresar los argumentos con que pueden vencer los fundamentalistas: Quemando a los herejes se acaba el libre pensamiento.
    Es solido el argumento y merece “respeto” ahora que en la prostitucion del lenguaje “respeto” y “miedo” se han vuelto sinonimos para algunas personas.
    Walter

  32. Walter says:

    Como Eduardo no explica quienes son los personajes que cita como autoridades que sustentan la “veracidad imparcial del cristianismo”, y descalifica con ligereza a otros, aqui colaboro con algo:
    Edward Clarke (1841-1931) Abogado ingles que intervino en un juicio de Oscar Wilde. La cita es buena pero va contra el propio McDowell pues son sus testimonios los que se basan en lo sobrenatural.
    Otto Betz (1917- ) debe ser el Teologo Evangelico alemán que junto a Rainer Riesner ha escrito varios libros apologeticos sobre Jesucristo y los Manuscritos del Mar Muerto. No puede hablarse aqui de imparcialidad. Los apologistas se especializan en acomodar la historia a sus convicciones religiosas, igual que hace McDowell. La cita que le atribuyes de que “Ningún erudito serio se ha atrevido a postular la no-historicidad de Jesús” puede deberse a que Otto Betz no conocia a George Albert Wells (1926- ) reconocido erudito en el Nuevo Testamento que postula que Jesus es un mito, tampoco debia conocer a John E. Remsburg que menciono mas abajo. Tampoco conoce a Hermann Reimarus, Ernest Renan, David Strauss, Bruno Bauer, Maurice Goguel, A.E. Harvey, H.C. Kee, W.H.C. Frend, and W.S. Kissinger, por citar algunos ¿A quien conoce Betz?
    Josh McDowell (1939- ) se cita a si mismo como fuente de autoridad, se autodenomina exesceptico y se refiere a las “investigaciones historicas imparciales” del cristianismo que realizo ¡Cuando era alumno del colegio Kellog! Si ni ahora esta calificado como historiador, menos lo iba a estar cuando era un estudiante.
    Bertrand Russell (1872-1970) recibio el Premio Nobel de Literatura de Literatura en 1920. En matemáticas su gran contribución es ..Principia Mathematica.. en donde a partir de ciertas nociones básicas de la lógica y la teoría de conjuntos se deduce la totalidad de las matemáticas. Mostrando así el poder de los lenguajes formales, la posibilidad de modelar las matemáticas y la fertilidad de la lógica. Un libro profundamente influyente e importante que contribuyó al desarrollo de la lógica, la teoría de conjuntos, la inteligencia artificial y la computación.. En filosofía contribuyó prácticamente en todas las áreas, .. abogando siempre por el análisis y alertando a los filósofos de las trampas del lenguaje, sentando así el método y las motivaciones de la Filosofía Analítica (Wikipedia). ¿Y cual es el aporte de McDowell al conocimiento humano?
    Friedrich Nietzsche, fue un filósofo, psicólogo y filólogo clásico alemán. Fue un crítico severo de la moralidad, el utilitarismo, la filosofía contemporánea, el materialismo filosófico, el idealismo alemán, el romanticismo alemán y la modernidad en general. Es uno de los filósofos más leídos y escribió una gran cantidad de aforismos y formas de composición experimentales. Aunque su trabajo ha sido distorsionado e identificado con el romanticismo filosófico, el nihilismo, el antisemitismo, e incluso con el nazismo, él mismo negó a gritos estas tendencias en su trabajo, hasta el punto de oponerse a estas.. (Wikipedia) Que se haya vuelto loco en sus últimos días es irrelevante para el caso y que lo menciones es rastrero; no es prueba de que el cristianismo sea verdadero. ¡Salvo que creas que dios lo castigo por ateo!
    Adolfo Hitler: Basta citar “Mi Lucha” para saber que era un creyente cristiano: “La grandeza del Cristianismo no se debió a componendas con corrientes filosóficas más o menos semejantes de la antigüedad, sino al inquebrantable fanatismo con que proclamó y sostuvo su propia doctrina.” La Iglesia cristiana Catolica firmo un concordato con los nazis en 1933 haciendo la vista gorda de la matanza primero de socialistas, comunistas y sindicalistas y luego de judios. TAmbién los cristianos protestantes alemanes se aliaron a Hitler en los años de su ascenso.
    Pablo de Tarso (¿¿-??) Es una figura legendaria a nombre de quien hay algunas cartas cuya autenticidad es puesta en duda. En cuanto a la cita, es un galimatías seudo argumentativo que esconde la afirmacion, “la fe en Cristo es buena, todo lo demas no sirve”.
    Brilante y confuso siquiatra:¿quién? argumento anecdotico e irrelevante. Yo he escuchado a un capitan de navío experimentado jurar que vio un platillo volador y a los extraterrestres que lo tripulaban. ¿Que prueba eso?
    Un estudiante anonimo, una estudiante anonima, ¿? y sus razones de “orgullo” y de “moral” para no creer. Estas citas no son serias, ni prueban nada, son el sermon dominical de los evangelistas pidiendo que respondamos ¡Aleluya!
    William Ramsay (¿¿-??) el arqueolo famoso no lo debe ser tanto pues en la red solo aparece en los sitios evangelicos; el William Ramsay que aparece es el premio nobel de Quimica de 1904. De cualquier manera, segun autores que refutan a McDowell lo que lleva a decir al arqueologo Ramsay que Lucas era historiador es unicamente que “cita correctamentes numerosas locaciones geográficas”. Pero eso no prueba que lo que cuenta sea cierto. Muchos novelistas retratan fidedignamente la geografia de lugares donde transcurre su novela, pero eso no prueba que sus personajes sean reales.
    Monticio-Williams (?) Cuando busque en Google solo un hallazgo y era de un sitio llamado http://www.conoze.com, un foro donde aparece el escrito del Lic. Eduardo Cruz” ¡el mismo que estamos tratando! Sria bueno que Eduardo explicara quien es el tal Monticio y en que libro podemos encontrar la cita supuestamente probatoria.
    Voltaire (1694-178) Nuevamente una “prueba” jalada de los pelos, ¿qué tiene que ver lo que Voltaire dijo y que usaran su imprenta con probar que dios existe? Debias ademas indicar el libro en donde estan escritas las frases que citas (en todos los casos) pues he buscado la que atribuyes a Voltaire y no la he encontrado. Pero halle la siguiente variante: “Voltaire criticaba a la Biblia y ahora nadie lee a Voltaire y todos leen la Biblia”. Lo que ocurre es que las ideas de Voltaire ya forman parte del conocimiento aceptado de nuestra época, la Biblia en cambio se lee y relee porque como toda ilusión necesita reafirmarse.
    Philip Schaff (1819-1893) aunque lo presentas como historiador imparcial, en realidad es un teologo que escribio una historia del cristianismo basanda en las escrituras cristianas. ¿Que objetividad puede tener?
    Napoleón Bonaparte (1769-1821) si de citar se trata aqui va una de Napo: “¿Cómo se puede tener orden en un estado sin religión? La religión es un formidable medio para tener quieta a la gente”.
    “Eruditos”:
    JMD ¿Sera nuevamente Josh McDowll citandose a sí mismo como “erudito”?
    Michael Greene (1930- ) Tampoco es historiador, es un teologo y ministro britanico especializado en apologetica. Erudito en jusitificar su fe.
    Kevan (¿?) Debes explicar quien es este “erudito” pues en la red solo aparece otra vez tu mismo articulo, esta vez en otro foro.
    Ambrosio Fleming (¿?) El unico que aparece con ese nombre en la red es el inventor de la valvula diodo. Y claro, no podia faltar un enlace a ¡tu propio escrito!
    Edward Clarke: Si te refieres al mismo citado arriba, era abogado no historiador ni mucho menos erudito en el tema que nos ocupa.
    Lord Darling: A este ni lo busco, acepto que sea juez ingles, ¿y que? ¿Lo vuelve eso erudito en historia?
    Dr. A.C. Ivy (fisiologo) idem anterior
    Thomas Arnold (1795–1842) Sus puntos de vista religiosos eran los que primaban en la historia oficial de su época, aún no surgía la revisión esceptica de los escritos e historia cristianos.
    R.M: Cheyne Edgar; Igual que en otros casos este es un desconocido “erudito” que solo aparece en copias de tu escrito y en la obra de McDowell. ¿No sera R.M. un titulo eclesiastico”
    John Singleton Copley (1772-1863) Fue un politico ingles, No fue historiador ni mucho menos erudito.
    Muchos estudiantes imparciales: jajajajajajaja
    Walter
    Nota: Voy a tratar de tomarme un tiempo para publicar mis respuestas en todos los foros en donde aparece tu escrito.

  33. nestor rafael says:

    ESTE FORO ES EL MAS DESASTROSO DE TODOS. HAN UTILISADO TANTO LA PALABRA CAGAR, QUE TIENEN LA PAGINA HOLIENDO A MIERDA. PARA UNA MENTE QUE QUEDA SIN RECURSOS INTELECTUALES Y AL NO ENCONTRAR MAS ARGUMENTOS SOLIDOS PARA DEFENDERSE INTELIGENTEMENTE, LA VIOLENCIA VERVAL O FISICA ES EL ULTIMO RECURSO DE DEFENSA.¿COMO UNOS JOVENES EGRESADOS DE PRESTIGIOSAS UNIVERSIDADES ESCRIBEN TODO ESTA BASURA? ¿CREEN QUE MOSTRARAN MAS INTELIGENCIA QUE OTRO COSTENTANDO O CONTRAGOLPEANDO CON LA MISMA GROSERIA? ESPERO RESPUESTAS EN ESPECIAL DE JUNJAN Y ODYSSEO

  34. DIOS says:

    A Nestor Rafael: flaco favor dialéctico el tuyo a estos foros… Además de casi indescifrable esta última intervención aporta muy poco al debate…

  35. nestor rafael says:

    si dios lo entiende todo ¿entonces porque le cuesta tanto comprender lo que escribi? lo que dije fue sencillo, los principales temas escritos en este foro vienen cargados de groserias dejando en claro la falta de tolerancia de sus autores, pero si tambien quiere señor dios que yo tambien participe entonces lo hare.¿que si existio jesucristo? pues dejeme decirle que estoy convencido de eso.¿ y sabe porque muchos no lo creen ? por que no tienen como probar aquellas acciones que el realizo y que escapan a nuestra logica. asi de cencillo es.

  36. Walter says:

    Hola Néstor Rafael:
    En lo de las groserías basta que las ignores, no es necesario que las repitas; como tu bien señalas son evidencia de la falta de argumentos y nada se gana con ellas.
    En cuanto a Jesucristo el tema es si el personaje que nos describe el Nuevo Testamento existió HISTORICAMENTE. La duda surge debido a que la única fuente, hasta el momento, son las propias escrituras religiosas cristianas que tienen dos deficiencias fundamentales: 1) No hay corroboración histórica de los cuentos que relatan y por el contrario hay pruebas que los refutan; y, 2) Cita hechos sobrenaturales que carecen de verosimilitud, (“acciones que escapan a nuestra lógica”, como tu mencionas) que jamás ha sido comprobado que puedan existir (salvo en la imaginacion de los creyentes, claro).
    No se trata de agredir tu creencia particular, hay montones de creencias que hacen felices a mucha gente; pero como dijo Asimov, es como tener un millon de dolares en acciones de la bolsa que son falsas; les hace sentir muy bien mientras no vayan a cobrarlas.
    Tambien es interesante lo que cuenta Fernando Savater:
    ‘En un debate en París con el ex secretario de la ONU Butros Gali, sostuvo ante mi asombro la gran importancia de la astrología en el Egipto actual, que los europeos no valoramos suficientemente. Respetuosamente, señalé que la astrología es tan pintoresca como falsa en todas partes, igual en El Cairo que en Estocolmo o Caracas. Butros Gali me informó de que precisamente esa opinión constituye un prejuicio eurocéntrico. No pude por menos de compadecer a los africanos que dependen de la astrología mientras otros continentes apuestan por la nanotecnología o la biogenética. Quizá el primer mandamiento de la laicidad consista en romper la idolatría culturalista y fomentar el espíritu crítico respecto a las tradiciones propias y ajenas. Podría formularse con aquellas palabras de Santayana: “No hay tiranía peor que la de una conciencia retrógrada o fanática que oprime a un mundo que no entiende, en nombre de otro mundo que es inexistente”’.
    Saludos
    Walter
    Nota 1:
    -Fernando Savater (1947- ) es catedrático de Filosofía de la Universidad Complutense de Madrid. -George Santayana (1863-1952), filosofo, poeta y novelista español. -Butros Butros Gali (1922- ), politico y diplomatico egipcio Secretario General de las Naciones Unidas de 1992 hasta 1997. Cursó estudios de derecho internacional y ciencias políticas en universidades de su país, en la francesa Universidad de la Sorbona y en la estadounidense de Columbia. Fue profesor de derecho y periodista, hasta llegar a ministro de Estado de Egipto en 1977 hasta 1991 y más adelante viceprimer ministro.
    Nota 2:
    Se escribe: “utilizado” y no “utilisado”, “oliendo” y no “holiendo”, “verbal” y no “verval”, “sencillo” y no “cencillo”. Si eran errores tipográficos, mis disculpas.

  37. nestor rafael says:

    estimado junjan: ¿en que laboratorio se creo la primera particula viviente que tu dices?¿que cientificos fueron?…¿en que pais lo hicieron?¿cuales son los nombres de estos cientificos?..te lo pregunto porque lo ley en uno de tus comentarios ¿ no es asi? entonces enfrentate y responde ante estas preguntas,da respuestas certeras impresionanos a todos y te aseguro que los debates en estos foros acerca del origen de la vida quedaran solucionado.. ¿estuviste presente el dia en que estos cientificos crearon vida en su laboratorio? ¿como lo hicieron?…¿ lo hicieron por medio de la materia inerte como neciamente insisten en que hasi fue como aparecio la vida en la tierra?..¿ que otros procedimientos utilizaron? ..¿sometieron, como tu dices ,a estas particulas inertes a un ambiente artificial que simulaba el estado climatico y evolutivo de la tierra hace millones de años y que por medio de acidos fuertes, elevadas temperaturas, grandes presiones y cuanto condimento se les ocurrio a estos cientificos lograron que esta particula inerte reaccionara y tomara atonomia y movimiento propio?… vaya la eureka que gritaron . ¿no es asi? primero pruebalo: los nombres de los cientificos , y el procimiento detallado que realizaron por el cual los llevo a crear vida. el que te escribe buscara por su parte las pruebas que refutaran tus afirmasiones

  38. Walter says:

    Nestor:
    No creo que necesites que Junjan te explique lo que sostiene la ciencia actualmente sobre el origen de la vida en nuestro planeta; basta que leas algun libro de biologia o visites un sitio web de divulgacion cientifica para que satisfagas tu curiosidad, por ejemplo http://natureduca.iespana.es/bio_origen_vida_teoria.htm.
    donde dice, entre otras cosas:
    “Stanley Miller en 1953, como parte de su tesis doctoral dirigida por H. Urey; consiguio obtener compuestos orgánicos complejos después de reproducir las condiciones primitivas del planeta en un aparato diseñado al efecto. Miller creó un dispositivo, en el cual la mezcla de gases que imitan la atmósfera primitiva, es sometida a la acción de descargas eléctricas, dentro de un circuito cerrado en el que hervía agua y se condensaba repetidas veces. Se producían así moléculas orgánicas sencillas, y a partir de ellas otras más complejas, como aminoácidos, ácidos orgánicos y nucleótidos.
    Se abrió así camino a la obtención de numerosas moléculas orgánicas. En condiciones de laboratorio se han conseguido sintetizar azúcares, glicerina, aminoácidos, polipéptidos, ácidos grasos, o porfirinas que es la base de la clorofila y hemoglobina, etc.
    La vida surgió en unas condiciones ambientales muy distintas a las actuales, las de la Tierra primitiva, a partir de moléculas orgánicas que no competían con ningún otro organismo vivo.
    Una condición indispensable para la evolución de la vida a partir de materia orgánica no viva, era la existencia de una atmósfera terrestre carente de oxígeno libre (véase el artículo Formación de las primeras células). En opinión de Haldane, que sostenía esa idea, durante el proceso biogenético los compuestos orgánicos no podrían ser estables en una atmósfera oxidante (con O2); serían los organismos fotosintéticos los que posteriormente producirían el O2 atmosférico actual.
    En resumen, la vida surgió en unas condiciones ambientales muy distintas a las actuales, las de la Tierra primitiva, a partir de moléculas orgánicas que no competían con ningún otro organismo vivo. Mediante la intervención de la selección natural se habrían ido diversificando hasta los actuales organismos. ”
    El asunto no es de una competencia retorica, es de estudio e investigacion. Es cierto que hay mucho que no se sabe, o que se especula o que se yerra. Pero asi funciona el metodo cientifico, se presentan teorias y se buscan comprobar si son ciertas o no, se corrige y se sigue investigando.
    Comprenderas que si tienes una teoria alternativa al respecto, debes presentar tus argumentos, el descalificar a la ciencia no prueba que haya otra explicacion. Por ejemplo, si la vida vino de otro planeta, debemos preguntarnos, que pruebas hay de ello. Y aun en el supuesto que hubiera pruebas de elo, eso solo transfiere la pregunta al otro planeta, y debemos entonces averiguar como surgio en ese otro planeta. Es lo mismo que con la idea del Dios creador, si decimos que Dios hizo todo, para ser consistentes con la necesidad de un origen primigenio debemos preguntrnos tambien quien hizo a Dios.
    Walter

  39. Walter says:

    Nota: Se escribe “asi” y no “hasi”, “afirmaciones” y no “afirmasiones”; aunque, valgan verdades, han disminuido los errores ortograficos y eso es bueno.

  40. Lic. Eduardo Cruz says:

    Mi respuesta a Walter:
    Hola Walter ¿como esta? espero que muy bien;
    Fíjese que yo también fui un hombre sinceramente equivocado y gracias por disponer de su valioso tiempo para leer, contestar e intentar refutarme.
    Sobre Voltaire:
    Para empezar ni Voltaire, ni usted, ni yo, tenemos la culpa de que la misma historia irónicamente convirtiera en una imprenta de biblias a su propia casa.
    Así sucedió y ¿que le podemos hacer?
    Sobre Bertrand Russell
    No se pone en duda la aportación a la humanidad del “premio novel”…
    lo curioso del caso es que El “ensayito” de el “Sir” fue hecho sin tomarse la molestia de haber leído antes lo que intento refutar (el N.T.) ¿cómo le puede uno llamar a eso? Es una cruda realidad sobre todo si proviene de un gran premio novel y perdone usted si le pareció insultante llamar “borrego” a aquel que sustenta sus afirmaciones en contra del cristianismo en meras presuposiciones filosóficas
    *Sobre Nietzsche
    su comentario: “Que se haya vuelto loco en sus últimos días es irrelevante para el caso y que lo menciones es rastrero; no es prueba de que el cristianismo sea verdadero”
    esto dice su biografía
    “Pero sus obras no tenían el éxito esperado y se iba quedando cada vez más solo. En el año 1882 fue la publicación de su obra “Así habló Zaratustra” ; en 1888 “El Crepúsculo de los ídolos” y a principios de 1889, en Turín, cuando ya estaba casi ciego, Nietzsche sufrió una de sus muchas crisis de locura de la que ya no se pudo recuperar. Estuvo internado en una clínica de Basilea y, después, en otra de Jena, hasta que su madre se lo llevó consigo. Nietzsche vivió los últimos doce años de su vida en un estado de aletargamiento, bajo los cuidados de su madre y luego de su hermana, hasta que murió en el año 1900”.
    Creo que SI es importante mencionarlo porque 12 años antes de su muerte se fue quedando loco y precisamente fue cuando escribió algunos de sus ilustres libros…
    por sentido común al menos ¿confiaría usted en un “loco” para adoptar “fanáticamente” en su defensa su postura filosofica?
    *Coincido fielmente con la opinión de Napoleón Bonaparte (1769-1821) y lo cual usted menciona: “¿Cómo se puede tener orden en un estado sin religión? La religión es un formidable medio para tener quieta a la gente”.
    Y aunque ha sido muy trillada esta famosa (pero certera) frase; definitivamente estoy de acuerdo con él …(así como usted)
    …porque si hay algo que es contrario al cristianismo puro, es la religión cualquiera que esta sea sobre todo si proviene de la manipulación, el chantaje y la tergiversación de una “fe” errada; proveniente de Roma
    *No confunda usted por favor a la “gimnasia” y la “magnesia”
    al escribir “argumento anecdotico e irrelevante” por omitir los nombres de los 2 estudiantes y un psiquiatra… creame fue tan solo para no avergonzarlos públicamente
    *y sobre la historicidad de Jesucristo:
    ¿no le basto la lista de escritores que aun en contra del cristianismo confirman la existencia de Jesús?
    Talos; por ejemplo escribió alrededor 52 d.C.
    LEA algo sobre Thomas Paine que por cierto es enemigo del cristianismo… y le sugiero que rectifique bien su posición con respecto a este punto sobre todo antes de publicarlo para no auto desacreditarse usted mismo
    Las patadas de ahogado…
    Las especulaciones y las conclusiones impulsivas a las que usted llega sobre la erudición de las personalidades antes mencionados para intentar desacreditarlos (por no decir ridiculizarlos) no prueban nada tampoco y he aquí unas ilustrativas definiciones que tomé a su estilo (por la red y espero no le predisponga:
    ERUDITO, ta: Que tiene o demuestra erudición: un erudito en un tema. ETIMOLOGÍA: Del latín eruditus, y este de erudire (quitar la rudeza, enseñar).
    ERUDICIÓN:
    s.f. Conocimiento amplio y profundo adquirido mediante el estudio, esp. el relacionado con temas literarios o históricos y basado en el examen de fuentes y documentos; por ejemplo: El rigor y la erudición del ensayo presentado impresionó al tribunal.
    ESOTERICO, ca :
    1 Oculto, secreto o reservado: temas esotéricos.
    2 Que es incomprensible o de difícil acceso para la mente
    ETIMOLOGÍA: Del griego esoterikós (reservado para los adeptos).
    SEMÁNTICA: Dist. de exotérico (común, accesible o fácil de comprender).
    Y en sus propias palabras:
    “Voy a tratar de tomarme un tiempo para publicar mis respuestas en todos los foros en donde aparece tu escrito.”
    Me parece una “falacia” su posición seudo-intimidante y “disque”-amenazadora con la cual concluye usted su ultimo mensaje dirigido hacia mi persona y ante la cual
    ¡estoy temblando pues me ha robado el sueño!…
    …pues de esto se trata cuando se intenta discutir y aprender de otros en un debate abierto por el Internet
    …la imparcialidad de la evidencia sigue hablando por si misma…
    *Finalmente me llama la atención como sus“profundas” investigaciones fueron hechas en algunos sitios de Internet de “google”
    únicamente entre el 2 y el 4 de marzo del presente en un transcurso de ¿unas cuantas horas (48 max)? y no en bibliografía seria…
    (no tengo nada en contra del Internet como herramienta de investigación sistemática,)
    …el gran abismo de diferencia es que Mc Dowell… (y no lo estoy defendiendo) …empleo mas de 5000 hombres hora basados en fuentes primarias de documentación seria, con mas de 1300 diferentes referencias bibliográficas de modo que los resultados fueran cuidadosamente dignos de confianza; además de un equipo de estudiantes de diferentes universidades.
    Finalmente después de más de 700 horas de estudiar concienzudamente este tema que él mismo intento refutar…
    (esto quiere decir que según su posición … si no aparece en el Internet ¿no existe?… ¿o que?)
    …también existen los libros…
    Recuerde que el urdido sarcasmo y la fina ironía es un arma de doble filo, porque si profesamos ser sabios en nuestra propia opinión, podemos fácilmente caer en la necedad…
    (p. d.) agradezco a usted por tomarse la molestia de publicar las fechas de nacimiento (y muerte)de algunas personalidades que anteriormente mencioné quienes por cierto antes de ser creyentes investigaron …
    he aquí el beneficio de la duda
    y conste que de usted salio la siguiente frase sobre mi “aburridísimo panegírico”
    ¡ALELUYA!
    (Por cierto; revise usted mas seguido su ortografía)

  41. Walter says:

    Hola Eduardo:
    Que prueba esto: Imprenta de Biblias Voltaire.
    Se escribe “Premio Nobel” y no “premio novel”
    ¿Como sabes que Russel no leyo el Nuevo Testamento? ¿Supones o tienes prueba de ello?
    El insulto “borrego” implica que hay un pastor al que se sigue ciegamente, ¿de que pastor era borrego Russell?:
    No dije que Nietzche no se haya vuelto loco, dije claramente que eso era irrelevante y que no probaba nada, salvo que tu creyeras que “era un castigo de dios” ¿Lo era?
    ¿Qué te hace pensar que “adopto fanáticamente su postura filosofica”? simplemente te estoy refutando el que pongas su locura como prueba de que dios existe. ¿Es prueba?
    Napoleón. Me alegra que estemos de acuerdo con su frase, para mi significa que el famoso general sabia dominar a la gente con engaños, y como la religión es un engaño la usaba eficientemente. Claro que tu como evangelista quisieras igualar “religión” con “institución religiosa” y echarle toda la pelota al Vaticano, pero no, relgión es el conjunto de creencias y en Francia habia tambien hugonotes. Por lo demas tu lo citaste como uno de tus “eruditos”, creo que reconocerás que Napoleón era muchas cosas pero no historiador.
    Los estudiantes y el siquiatra: No interesan tampoco los nombres de los estudiantes, tienes que entender que esos testimonios personales no prueban nada. Te puse el ejemplo del capitan que vio extraterrestres, ¿prueba eso que existan? Hace poco escuche lo siguiente: “Después de 9 años de investigación sobre 9,000 pacientes con problemas cardiacos a los que se les suministro vitamina E, se sospecha que la vitamina E no es muy favorable para dichos pacientes.” Eso se llama investigacion científica, asi se busca la verdad, no con declaraciones emocionales aleluyescas.
    La lista de escritores que presentas no prueban que haya existido Jesucristo pues ninguno habla de la vida Jesús de primera fuente ni con detalles históricos, tampoco de los apostoles, a lo mas hay referencias a lo que decian los cristianos posteriores a la supuesta existencia de Jesús. Otros de tus escritores han sido burdamente falsificados; te pongo un ejemplo: Josefo, judio fariseo, afirma en un sospechoso parrafo que Jesús es el Mesias y que resucito; Origenes cita extensamente a Josefo en el siglo III y no menciona dicho parrafo, recien es mencionado en la obra de Eusebio en el siglo IV (año en que eligieron por mayoria de votos 4 evangelios entre cientos de evangelios contradictorios que habian en circulación) Si lees a los eruditos biblicos que no son fundamentalistas cristianos te daras cuenta de que todos reconocen que el parrafo de Josefo es una “inserción piadosa” posterior (léase fraude).
    Por el contrario, te he pasado una lista extensa de escritores contemporanes que no mencionan para nada a Jesucristo ni a los apóstoles. ¿Qué dices de eso?
    Talos: ¿Podrias decirme quien era, en que obra habla de Jesucristo y citar el parrafo?, despues te comento.
    Sí, he leido a Thomas Paine, tengo varios libros de él; te agradeceria que me indiques que pagina de que obra encuentro pruebas de lo que tu dices y te lo comento.
    Estoy de acuerdo en lo de la erudición, el asunto es que el ser erudito en Apología Cristiana no te hace necesariamente erudito en historia. Y eso es lo que ocurre con tus eruditos, carecen de imparcialidad algunos y otros de autoridad en temas historicos, y por eso hice referencia a ese defecto. No hay imparcialidad, hay defensa de la fe. Asi McDowell haya empleado un millón de hombres y horas, sus afirmaciones carecen de rigor histórico. Te comente el caso de el tal Betz que afirmaba que Lucas era un historiador serio porque citaba varias locaciones geograficas con exactitud. Te pregunto ¿Eso hace que todos sus cuentos sean verdaderos? ¿Realmente eso te parece prueba? Tambien te comente que McDowell no es considerado historiador ni erudito biblico, es un divulgador popular de apologética cristiana. Trata de leer un poco también a sus críticos para que abras tu mente.
    El resto de tus comentarios me parecen irrelevantes, de muy mal gusto y que esconden una nada cristiana intencion de ofenderme. No importa, pongo la otra mejilla.
    Finalmente. no voy a publicar mis respuestas por intimidarte, lo hare por refutarte en todos los lugares en donde has copiado tu comentario “en cadena” porque es justo ¿no crees? ¿O no quieres que te refuten?
    Y en cuanto a mi ortografia, te agradeceria mucho que pongas la lista de mis errores para corregirlos, es difícil darse cuenta uno mismo y quiero aprender a escribir mejor.
    Walter

  42. Walter says:

    Eusebio:
    Post data; Interesante tu disquisicion de que lo yo crea que “lo que no esta en Internet no existe”, tienes razon, faltan todavia muchas cosas. Pero no negaras que ya no es como antes de Internet en que nos podian hacer comulgar con ruedas de molino haciendo referencias inexactas o fuera de contexto pues ahora las podemos verificar y refutarlas rapidamente. Y eso me lleva a tu otro comentario con el que intentas desmerecer mis opiniones, a saber, el que yo haya podido refutar a McDowell en pocos dias mientras el se tomo 5000 horas hombre para escribir su libro. En lo que tienes razon es en que yo soy un don nadie, solo estoy aprendiendo. Lo que pasa es que a McDowell lo lei hace muchos años y tambien a quienes lo refutaron; asi que tu mensaje, mejor dicho tu TRANSCRIPCION RESUMIDA Y COMENTADA DE MCDOWELL no era original ni novedosa para mi. Diria por el contrario que me diste en la yema del gusto pues el tema o conocia y me apasiona. Y, por supuesto que recurri a Google, Yahoo y otros buscadores, pero la ventaja es que ya sabia donde buscar. Aleluya tambien por Internet.

  43. David says:

    Hola:
    Leí en “el mundo y sus demonios” de Carl Sagan, que Thomas Paine no era ateo. Creía en un dios, pero no era cristiano.
    En cuanto a Mcdowell coincido con Walter en que no es historiador.
    También creo que no se debe despretigiar la figura de Russell por ser agnóstico ni a Nietzsche por ser ateo.
    La enfermedad mental no es fruto de un castigo divino.
    Un saludo

  44. Walter says:

    Hola David:
    Excelente que hayas leido los libros de Sagan y Asimov; a mi me han servido mucho.
    Thomas Paine (1737-1809), es uno de los más importantes pioneros del libre pensamiento, escribio en épocas en que aún se creía en las brujas. Se declaraba deista pero rechazaba el cristianismo tanto catolico como protestante. Los fundamentalistas como Eusebio, quieren agarrarse de la creencia en Dios de algunos grandes pensadores para justificar las suyas, no obstante que hay una abismal diferencia entre sus concepciones. Así que sacan frases fuera de contexto y las acomodan a su conveniencia. Por eemplo, de Paine dicen que creia en Dios pero no dicen que consideraba falso el cristianismo, ni porque.
    Si lees a Paine, te encontrarás que rechaza al Jesucristo del Nuevo Testamente, es decir que si bien considera la posibilidad de un origen humano del personaje (y elogia sus normas morales), no aceptan de ninguna manera al mitico Jesus que se relata en las Escrituras.
    Y ese es el punto; más alla de si el mito de Jesus tiene su origen en uno o varios personajes reales, de lo cual no hay prueba, el asunto en discusión es SI ES REAL EL JESUCRITO DEL NUEVO TESTAMENTE, ESE QUE NACIO DEL CRUCE DE MUJER CON PALOMA, QUE ERA DIOS EN PERSONA, QUE HACIA MILAGROS, QUE RESUCITO A OTROS Y SE RESUCITO A SI MISMO, QUE METIO DIABLOS EN CHANCHOS Y LOS DESBARRANCO etc.. Ese Cristo que es parte del trinitario politeísmo esoterico cristiano, ese NO ERA ACEPTADO POR PAINE y ese es el que defiende Eusebio y los fundamentalistas cristianos. No defienden la idea abstracta de Jesucristo defienden la literalidad de la Biblia.
    Del gran Thomas Paine, te recomiendo que leas “La Edad de la Razon”, es muy bueno y apreciaras la claridad con que este ilustre pensador combatio el prejuicio religioso de su tiempo. (Te voy a pasar el enlace de donde lo puedes descargar)
    Walter

  45. Walter says:

    David:
    Aqui va el enlace:
    http://www.ushistory.org/paine/reason/
    Para leer la traduccion automatica al castellano de esta pagina, pones en Google: “Age of Reason ushistory” y cuando aparezca “Age Of Reason” de ww.ushistory.org
    presionas “Traducir esta pagina” (no se que tan buena sera la traduccion)
    Walter

  46. Junjan says:

    Walter, el comentarista se llama Eduardo, no Eusebio.
    Eusebio soy yo… :-)

  47. Walter says:

    Hola Junjan:
    Lamento el lapsus, parece que mi recurrente dislepsia digital tambien me esta afectando el coco, jajaja.
    A proposito de nombres, ¿tienes algun parentezco con el Eusebio Perdiguero que es biólogo molecular?
    Walter

  48. Junjan says:

    Si, el que viste y calza (que diría mi madre).

  49. david says:

    Hola Walter:
    Te agradezco que me indiques una web para leer las obras de Thomas Paine.
    Pero no domino con facilidad el inglés y las traducciones de Google son pésimas.
    No me cuesta leer cualquier obra, pero me gustaría comprenderla a fondo, y con las traducciones de Google no creo que lo consiga.
    Un saludo

  50. Walter says:

    Junjan:
    Entonces mis felcitaciones por la obtencion de la Beca PostDoctoral en Genomica.
    Walter

  51. Walter says:

    Hola David:
    Tienes razon, lei la Introduccion del libro de Paine traducida por Google y es practicamente ilegible. Si encuentro una versión de “La Edad de la Razon” en castellano te aviso.
    Saludos
    Walter

  52. david says:

    Hola Eduardo:
    Biografía de Nietzsche:
    Leí su biografía hace 3 meses, y vi que éste filósofo ni era nazi y mucho menos antisemita.
    Ante su relación con los nazis dijo:
    “¡No me confundáis con otros!”
    Antisemita:
    “Sus desavenencias con Richard Wagner, se debió; entre otras cosas, por que el compositor simpatizaba con el antisemitismo”
    “En una carta a un amigo (antiguo compañero de universidad)se puede leer: “los antisemitas deberían ser suprimidos”
    “Nietzsche podría ser cualquier cosa menos antisemita”
    Todas estas afirmaciones proceden de la biografía de la editorial Salvat.
    Se sabe también que su hermana Elizabeth estaba casada con un famoso antisemita, y durante el período en que se volvió loco, ella, (mientras lo cuidaba), tergiversó las obras de su hermano.
    “La dificultad de interpretación del pensamiento “nietzscheano”, provocada a partes iguales por la ambigüedad de sus expresiones y la manipulación de sus escritos publicados tras su muerte a cargo de su hermana, ha generado diversas apropiaciones de la figura y pensamiento del filósofo alemán. Así ha ocurrido con el nazismo, que se apropió de un concepto de “superhombre” simplificado y tergiversado, cercano a sus propios intereses. Por su parte, el marxismo realizó su propia interpretación, entendiendo al “superhombre” como la culminación de la dialéctica histórica representada por la lucha de clases. Con mayor profundidad y capacidad de aproximación, los trabajos de otro filósofo, Martín Heidegger, permiten conocer y comprender el pensamiento de Nietzsche en su globalidad y contexto.” (http://www.artehistoria.com)
    Ahora dejo unos párrafos de El Anticristo:
    “Es un puro disparate considerar la “fe”, por ejemplo, en la redención por Cristo, como la esencia del cristianismo: el cristianismo sólo es una práctica, es decir, llevar una vida semejante a la de Aquel que murió en la cruz…”
    “El “reino de los cielos” es un estado del corazón, no algo procedente de “más allá de la tierra” o “más allá de la muerte”. El concepto de la muerte natural falta en el Evangelio: la muerte no es un puente, ni un tránsito, sino ausencia de ellos, porque no existe otro mundo distinto; su existencia es pura ficción, mero símbolo. La “hora de la muerte” no es un concepto cristiano, porque la “hora”, el tiempo, la vida física y sus crisis, no existen para el Maestro del Evangelio…El reino de Dios es nada, espera y espera de la nada; no tiene pasado ni futuro; no vendrá en “mil años”: es una experiencia del corazón; está en todas partes, y en ninguna”
    ¿Donde está el odio a Jesucristo que Nietzsche le mostraba,Eduardo?
    PD: Y esto te lo digo, no como ateo, pues soy creyente, ni como cristiano, (aunque creo en Cristo).
    Un saludo

  53. david says:

    Hola Walter:
    En el foro “Jesucristo no existió”, me llamó la atención un estudio de Gordon Stein, que supuestamente demostraba la inexistencia de Jesucristo (aunque yo lo considero más una crítica a Mcdowell)
    Lo grabé en mi archivo, y tomé notas.
    Me gustaría discutirlas contigo.
    1. Gordon Stein no menciona el pasaje de Josefo acerca de la lapidación de Santiago, “hermano de Jesús, aquel llamado el Cristo”. (Antigüedades judías, XX.IX.I) El texto del capítulo 20 es filológica e historiográficamente más consistente que el testimonio flaviano; coincide formalmente con el estilo de Josefo, y parece poco probable una interpolación cristiana por la falta de énfasis hagiográfico y la mención de un «hermano de Jesús» (que habría resultado conflictiva para una fe que proclamaba la virginidad de María.)
    2. La validez y la autenticidad del pasaje de Tácito acerca del incendio de Roma y de la persecución de los cristianos por parte de Nerón nunca han sido cuestionadas por la mayoría de los historiadores.
    3. Por tanto, si el pasaje es verdadero, ¿por qué Tácito acepta una historia basada en testimonios cristianos (a los que el historiador era hostil) a menos que hubiera evidencias para creer en la existencia de dicho hombre? Se ha barajado la posibilidad de que se basara en Plinio el Joven, o en las confesiones de los propios cristianos frente a la persecución policial. El fragmento aparece en el contexto de una larga diatriba contra los males del gobierno de Nerón, indicando que el interés de Tácito no estaba en el fenómeno cristiano por sí mismo sino en la crítica al emperador.
    4. Gayo Suetonio Tranquilo (75-160), escribió acerca de los cristianos (o más bien en contra de ellos) alrededor del 120. Se refiere a que el emperador Claudio es el que expulsó de Roma a los «crestianos».
    5. Seguramente Suetonio escribe mal a propósito el nombre Christus (que el idioma latín había adoptado del griego con el significado de ‘ungido [rey]’) y la remplaza por chrestus, que en latín significa ‘buen hombre’, ‘simple’, ‘íntegro’, ‘útil’, pero que también se podía usar en el sentido peyorativo de ‘simple’, ‘ingenuo’, ‘tonto’ y era un apelativo aplicado a los esclavos (entre los que la liberal doctrina cristiana estaba teniendo más éxito).
    6. Iudaeos, impulsore Chresto, assídue tumultuantis Roma expúlita A los judíos, [siendo el] instigador el Simple, [siendo ellos] asiduos tumultuosos los expulsó de Roma. De Vita Caésarum. Divus Claudius, 25 (‘De la vida de los Césares: Dios Claudio’, 25) Luego, esa norma se derogó.
    7. Suetonio no menciona que “Chresto” estuviera en Roma. Tal vez se refiera “por causa de la doctrina de “Chresto”.
    8. No es cierto que la única prueba de la persecución de los cristianos por parte de Nerón sea el pasaje de Tácito, también hay una referencia en “Vida de los Césares” de Suetonio.
    Multa sub eo et animadversa severe, et coércita, nec minus instituta […]
    afflicti suppliciis Christiani, genus hóminum superstitionis nóvae ac maléficae.
    ‘Penalizó animadversiones severamente, y leyes coercitivas no [fueron] menos instituidas [o sea: fueron más instituidas que antes]
    [Nerón] infligió suplicios a los cristianos, un género de hombres de una superstición nueva y de hecho maléfica.’
    De Vita Caésarum. Nero, 16 (‘De la vida de los Césares: Nerón’, 16)
    Un saludo

  54. Lic Eduardo cruz says:

    Efectivamente que bueno que tenemos a la mano el acceso al intermet (google, yahoo, etc) por que de otra manera hace tal vez una generación atrás no hubiesemos tenido la oportunidad de conocernos ni dialogar tan rápidamente (casi instantáneamente)
    Nunca hice (ni intente dejar a la imaginación) el afirmar que Nichetze hubiese sido castigado por ser ateo; (para David) ni mucho menos que odiara a Jesucristo , ni que fuera nazi o anti semita.
    Ciertamente fue y tuvo una vida difícil, el problema principal creo yo radica un que algunos de sus libros fueron escritos en sus últimos años de vida cuando (a pesar de su agudo ingenio literario y filosófico)
    sufría algunas crisis de locura y de la ultima ya no pudo recuperarse.
    El punto es que algunos ateos basan su posición radical en contra del cristianismo en los escritos de Nichetze. ¿cómo se puede confiar en su literatura cuando sufría de estos terribles padecimientos?
    Por lo tanto Nunca afirme (ni afirmare sin pruebas) que el se volvió loco por ser ateo.
    (perdón por lo de novel y Nóbel)
    Nunca afirme que Napoleón fuese historiador simplemente escribí algunas de sus propias palabras en su opinión sobre Jesucristo.

  55. Walter says:

    Hola David:
    Gordon Stein basa sus afirmaciones en los estudios de de Arthur Drews, Nathaniel Lardner y G.A. Wells.
    En cuanto a los puntos que señalas, mi opinion es la siguiente:
    1.- El fraude del “testimonio flaviano” es suficiente prueba de las artimañas adulterativas que contiene la historia oficial cristiana. La probable veracidad de la cita de Santiago es puramente especulativa.
    2.- En cuanto a Tacito, eso de que “nunca ha sido cuestionada” NO ES CIERTO.
    Y lo reconoces al agregar “por la MAYORIA de historiadores” a menos que digas que la verdad se decide por mayoria de votos.
    3.- Aun siendo verdadera la cita de Tacito, no habla de Jesus sino que repite lo que de el dicen los cristianos respecto a la crucifixion; no hace ninguna mencion de ningun hecho de su vida.
    4. y 5. 6.- Tu mismo relativizas tu comentario al decir “seguramente Suetonio”; aventurando una posibilidad NO PROBADA. Lo concreto es que la cita es clara y habla del instigador Chrestus en el reynado de Claudio. Lo que dices es pura especulacion.
    8.- Acepto que Tacito no es la unica referencia de que se sanciono a los cristianos, pero de alli al martirologio ofical hay un abismo de diferencia; por lo demas eso tampoco prueba que Jesus existio.
    Ahora te pido que reflexiones en dos puntos:
    a- La palabra Cristo significa Mesias y hubo muchos movimientos mesianicos, es decir cristianos y muchos Mesias, es decir Cristos desde 100 años antes del supuesto nacimiento del llamado Jesus.
    b- Aun aceptando las dudosas referencias de Tacito y Suetonio, SON ridiculamente BREVES y genericas para ser las unicas pruevbas. Más arriba puse una lista de 45 historiadores que no mencionan a Jesus y repito la pregunta que se hace alli: “¿Por qué no ha sobrevivido ningún manuscrito que mencione al “Jesús del NT” y se refiera a lo ocurrido entre los años del 30 al 40… pese a la cantidad de escritores que podrían haberlo mencionado…?”
    Saludos
    Walter

  56. Lic Eduardo cruz says:

    Walter perdóneme si te pareció “nada cristiana” mi respuesta al escribir “El resto de tus comentarios me parecen irrelevantes, de muy mal gusto y que esconden una nada cristiana intención de ofenderme. No importa, pongo la otra mejilla” .
    Y mas que la otra mejilla, (por que no) la mano, en un cordial saludo y me da gusto que coincidimos en que nos apasiona el tema y en la definición de religión a lo cual yo añadiría el comentario y frase famosa de “la religión el oprobio de los pueblos”…
    Creo que es una buena oportunidad que tengo para aprender más de usted (y de David) no diga que es usted un don nadie pues si afirma que ya leyó la literatura de Mc Dowell y a sus refutadores, me gustaría pues que me enviara las refutaciones en castellano (pues no domino el ingles al 100) para enriquecer un poco mas mi investigación y analizarla;
    Creame, no por el hecho de creer en Jesucristo voy a rechazar esta literatura predisponiéndome…
    Por otro lado; para desacreditar los testimonios personales (yo) tendría primero que sufrir de amnesia para olvidar el mío (por algunos puede ser tomado como subjetivo pero esta basado en una realidad objetiva); mi fe no esta basada en emociones ni experiencias “místicas” o “esotéricas”
    Aunque no tendría nada de malo que las escribiera con lujo de detalle si fuera necesario y eso nadie me lo puede refutar pues sucedieron verdaderamente y hasta la ciencia no tuvo una explicación y seria necio tratar de olvidarlo; (la sanidad de mi madre de cáncer, mi padre del alcoholismo a pesar e tener cirrosis hepática delirius tremend y epilepsia, y a mi…) haberme librado de las garras de la pornografía (por ejemplo).
    Atribuyo y no me (avergüenzo de hacerlo) a Jesucristo, el haber perdonado a mi padre y el que hoy pueda cada vez que lo veo abrazar al Viejo. Los “milagros” son los interiores no los externos….
    Aparte tendríamos que ignorar los miles (o millones) de testimonios al rededor del mundo (y no exagero) de vidas cambiadas mas que por algo “emocionalmente aleluyesco” (como usted dijo) o “subjetivo” ni tampoco en ninguna religión, sino simplemente en Jesucristo.
    Finalmente yo no le quiero “echar toda la pelota al Vaticano”
    basta con estudiar un poco de historia para hacerlo.

  57. Lic Eduardo cruz says:

    Mi respuesta a Junjan:
    Usted me llama “pollino de cierto calibre”
    Y efectivamente me llamo Eduardo Cruz (no me ando escondiendo tras cobardes seudónimos) aunque eso no es lo importante realmente…
    ¿Por que no pudo usted refutarme como lo ha intentado hacer su amigo Walter?
    ¿Le ofendió mi primer comentario en este foro para que me llame usted así?
    ¿por que tuvo que recurrir a Walter para “esconderse” y responder con urdida agresión?
    ¿es usted a caso el moderador de este foro?
    Baje un poco la guardia y el sarcasmo pues nunca ha sido mi intención agredirle verbalmente ni a usted ni a nadie en este foro…
    (P.D. le sugiero que lea mi comentario final dentro de mi primer mensaje)

  58. Walter says:

    Vale, Eduardo.
    Sobre Nietzche, recuerda que los genios siempre tienen algo de locos. Y me parece que los aportes de los grandes pensadores, (Nietzche, Voltarie, Paine, Hume, Russell, etc.) al conocimiento humano, ya forman parte del pensamiento comun de la gente. En mi caso, es muy probable que haya encontrado en Nietzche, cuando lo lei hace 20 años, cosas que abrieron mi mente, ahora no recuerdo cuales eran. Mis puntos de vista las defiendo con mi propia lógica (muy modesta, por cierto), no como seguidor de nadie, tampoco quiere decir que no este dispuesto a escuchar o leer a todos.
    En el foro vecino, “Castigo de Dios”, aparece un excelente articulo sobre religión de David Andres Galeano, que me gustaria que leas (posteado hoy dia por Enzo)
    En lo de la refutacion a McDowell en ingles, lamentablemente no la he encontrado en castellano y es muy extensa para que pueda traducirla, ademas podria no hacerlo adecuadamente. Si la encuentro en la red en castellano te aviso.
    No puedo discutir tus emociones, ni las de nadie, pero no creo que sean fuente de conocimiento ni que prueben que Dios existe.
    Respecto al Vaticano, no solo que estoy al tanto de sus monumentales culpas sino que estoy buscando un libro llamado “La Santa Alianza” de Eric Frattini, en donde se recuentan documentadamente sus tramoyas. Mi enfasis era en que las Iglesias Protestantes también son parte de la religión a que se refería Napoleon, también entraban y entran en las componendas por el poder, también quemaron brujas y herejes, también apoyaron al Hitler anticomunista y antisemita de los primeros años; en fin, comparten la culpa. No es exclusiva del Vaticano. Para graficarlo repito el poema atribuido (PD3) al Reverendo Protestante Martin Niemoeller, partidario de Hitler cuando éste subio al poder:
    “Primero se llevaron a los comunistas, y yo no protesté porque yo no era comunista.
    Luego se llevaron a los sindicalizados, y yo no protesté porque yo no era del sindicato.
    Luego se llevaron a los judíos, y yo no protesté porque yo no era judío.
    Finalmente vinieron por mi. Para entonces no quedaba nadie que pudiera protestar.”
    Saludos,
    Walter
    PD: No te olvides de pasarme la lista de mis errores ortograficos, no me vas a incomodar evidenciandolos, me ayudaras a corregirlos En los acentos si me tomo licencias pues mi máquina a veces no los pinta; los errores tipograficos se deben a una incurable dislepsia dactilar y pobre visión; y la falta de concordancia a correcciones de última hora.
    PD2: Fe de erratas: Algunos comentarios anteriores dirigidos a Eusebio eran para tí. Lamento la confusión.
    PD3: Digo atrbuido a Niemoeler pues hay serias dudas sobre su autoría, pero aparte del toque melodramatico, el poemita retrata bien lo que realmente paso. Hitler termino enviando a Dachau a Niemoeller.

  59. david says:

    Hola Walter:
    Esto afirma la hagiografía de Cristo, según la Wikipedia.
    “Aunque la autenticidad del texto de Tácito no ha sido cuestionada, numerosos autores han indicado que se carece de indicaciones sobre sus fuentes…”
    Luego no estoy mitiendo, ni estoy equivocado.
    Todas mis afirmaciones, las puedes encontrar en Wikipedia, y en cuanto al incendio de Roma y las persecuciones a los cristianos en http://www.artehistoria.com.
    Un saludo

  60. david says:

    Hola de nuevo:
    En cuanto a Gordon Stein, no me parece fiable.
    Dice que la única prueba que se tiene de las persecuciones de Nerón hacia los cristianos es la cita de Tácito, pero ya encontré otra cita de Suetonio.(ya la cité anteriormente)
    Un saludo

  61. david says:

    Hola Eduardo:
    Te pido perdón si te malinterpreté en alguna de tus afirmaciones respecto a Nietzsche (espero no haberte ofendido).
    Si Hitler estaba influenciado por Nietzsche, sería por las manipulaciones de su hermana Elizabeth. Si se hubiese enterado de su simpatía hacia los judíos y su negación al nazismo otro gallo cantaría.
    También se ha manipulado el mensaje de Jesucristo (por ejemplo, ahí tienes la Inquisición, el antisemitismo y las cruzadas), el mensaje de Buda, y el de Karl Marx.
    En cuanto a la locura de Nietzsche (pese a que no comparto su ateísmo), creo que no es razón para rechazar sus textos.
    Dalí y Vicent Van Gogh estaban locos y eran unos genios.
    Un saludo

  62. david says:

    Hola de nuevo, Eduardo:
    Aunque no he leido “Evidencias que exigen un veredicto” de Mcdowell (y por la crítica de Gordon Stein no creo que me interese) si he leído “Más que un carpintero” (del mismo autor)
    Me pareció una buena obra, aunque no se la puede considerar como obra de divulgación histórica.
    Mcdowell, me parece una persona agradable e inteligente.
    Por ejemplo, me enseñó a creer de forma no dogmática.
    En cuanto a “Evidencias…”, no creo que se la pueda considerar historia.
    Muchos de los textos que menciona (excepto el de Tácito y la narración de la lapidación de Santiago según Josefo)no se pueden considerar pruebas de la existencia de Jesús.
    Un saludo

  63. Walter says:

    Hola David:
    No dije en ningun momento que estes mintiendo ni que estes equivocado, hablo de especulación. Las citas de Tacito y Suetonio las puedes encontrar en Internet y verificar lo que dicen, todo lo demas es especulativo (a favor y en contra). Eso es todo lo que hay. No es necesario ser erudito para darse cuenta de su insuficiencia como prueba de la existencia de Jesus.
    Lo demas de la discusión hagiografica resultaria muy extensa y aburrida pues se aleja del punto central que es probar que Jesucristo existio, no probar que Neron incendio Roma o persiguio a los cristianos, pues, te repito, aun en caso fuera así, eso no prueba que Jesucristo haya sido una persona de carne y hueso. Para formar la religion y para que haya seguidores y martires bastaba el Jesucristo mítico de los evangelios no era necesaria la persona real. Una prueba historica sería por ejemplo que Tacito o Suetonio mencionaran una carta de Pilatos, o la lista de ejecuciones del año 33 en Palestina y que se mencionara en ellas a un tal Jesus (no Cristo que quiere decir elegido y por su epoca habia muchos Cristos, es dcir muchos Mesias) que se creia dios y murio clavado en una cruz. No te pido siquiera que demuestres que resucito! que es parte del creer en Jesucristo.
    En cuanto a las persecuciones cristianas, no se puede decir que porque hubo dos momentos en que se persiguio a los cristianos (si fue asi), entonces toda la historia del martirologio cristiano contado por los propios creyentes es cierta. Muchísmo menos que eso pruebe que Jesucristo existió.
    Sabia que desconfiabas de Stein, por eso te cite las fuentes en que el escritor cita como referencias para que las revises.
    En la version en ingles de Wikipedia dice:
    “Some scholars, such as Gordon Stein, have suggested that this could be a later textual interpolation by Christian scribes. The 19th-century scholar John Wilson Ross suggested that the Annals themselves had been forged by the Renaissance humanist Poggio Bracciolini, but his thesis has found no support among classicists and palaeographers. Unlike the case with Josephus on Jesus, however, there is less clear evidence for doubting the authenticity of this text; debate focuses rather on the nature of Tacitus’s sources.
    A common suggestion is that Tacitus got his information from Rome’s archives – perhaps from a letter or account written by Pilate, though the existence of any such letter is pure speculation. Nor is there any evidence that any records of Jesus’s trial were held in Rome. The fact that Tacitus never refers to “Jesus”, but only to “Christus” (“annointed one”) suggests that he did not use archival sources, in which this title is unlikely to have been used, but rather derived his information directly or indirectly from Christians. H.G.Wells and others object that it is unlikely that Tacitus accessed official documents or had access to the imperial archives.”
    NO DICE QUE NADIE CUESTIONA LA CITA DE TACITO COMO PRUEBA DE LA EXISTENCIA DE JESUCRISTO. DICE CLARAMENTE QUE HAY QUIENES LA CUESTIONAN. Además hay que diferenciar dos aspectos: uno, si la cita es una falsificación cristiana y; dos, si Tacito hablaba de un Jescristo cuya existencia le constaba o solo repetia lo que decían los cristianos de su Dios.
    En ningun caso se discute si Tacito prueba que Jesucristo existió por que NO LO PRUEBA.
    Saludos
    Walter
    Nota: Hay mucho mas en Wikipedia y seguro que va a seguir creciendo la cantidad de informacion sobre el tema. Wikipedia es una Enciclpedia abierta a edicion y debate.

  64. Lic. Eduardo Cruz says:

    Hola David
    No hay nada que aclarar sobre malos entendidos…
    Coincido con usted definitivamente que Salvador Dalí y Vicent Van Gogh estaban “algo” locos y eran unos genios.
    Yo me dedico profesionalmente a la música y sé apreciar el arte de tales genios…
    He tenido la oportunidad de viajar a algunos países llevando mi música como un medio (no de manipulación) sino de comunicación no apelando a las emociones sino a la razón.
    No permita que Gordon Stein le predisponga y a pesar de las duras criticas de algunos en este foro.
    Le podría sugerir leer mi primer mensaje en este foro (como un preámbulo de el libro) pues es un “resumen” o como dijera Walter “TRANSCRIPCION RESUMIDA Y COMENTADA DE MCDOWELL” ;
    Cuídese y estoy para servirle…
    Eduardo Cruz

  65. Walter says:

    A proposito de erudición:
    A menudo mis alumnos me preguntan si la hermenéutica telúrica incaica transtrueca la peripatética anotrética de la filosofía aristotélica, por la inicuidad fáctica de los diálogos socráticos no dogmáticos. Yo siempre les respondo que no.
    Que no qué
    Que no sé.
    Disculpeme, ¿Alumnos de que ?
    De Basketbol
    Les Luthiers

  66. david says:

    Hola Walter:
    No sé de que manera se puede decir que Jesucristo no es histórico.
    También se ha dudado de la existencia de Homero, Lao Tsé, Buda, etc (ya lo hablamos en “Jesucristo no existió”) pero los libros de historia los trata como históricos (separando a la persona del mito).
    Y durante un tiempo también se ha dicho que tanto Troya como Pompeya eran ciudades legendarias.
    Puedo coincidir contigo en que la persona de Jesús se halla mitificado, pero no quita su existencia.
    En cuanto a Gordon Stein, no es que desconfíe de él, sino que creo que no puede ser fiable al decir que la única prueba de las persecuciones a cristianos que se tiene es la cita de Tácito cuando hay una de Suetonio.
    Cito:
    “Al contrario de lo que nos hacen creer en las clases de Religión y en las películas de Hollywood, no hay ninguna otra prueba histórica de que Nerón persiguiera a los cristianos en absoluto. También se cree que la supuesta persecución de Nerón a los cristianos en este texto es una interpolación cristiana basada en los Martirologios, obviamente sin ningún valor histórico, escritos por los padres de la Iglesia Católica. ”
    Sobran comentarios.
    No digo que las persecuciones prueben la existencia de Jesús.
    Creo sin embargo, que los apóstoles que vivieron en aquel tiempo, sabían lo que decían. Y no creo que estas personas fueran todas ignorantes, que siguen a un mesías inexistente y llegaran a morir por él.
    Un saludo

  67. david says:

    Hola Eduardo:
    .- Cornelio Tácito: Historiador ROMANO (aprox. 52 – 120 d.C.)
    – Suetonio: Historiador ROMANO (año 120)
    – Flavio Joséfo (ben Matatias): (año 37)
    Creo que sólo estos tres mencionan a Cristo, (o Crestus o “Jesús, aquel llamado el Cristo”)
    Aparte de los evangelios y las epístolas de Pablo.
    En cuanto a las demás citas (reconozco que no las conozco todas), he de decir lo siguiente:
    – Plinio Segundo: “el menor” o “el joven”: Gobernador de Bitinia (año 112):La obra (escrita cerca del 112 AD.) establece que los cristianos estaban cantando un “himno a Cristo como un Dios…”. Por supuesto, eso perfectamente pudo haber ocurrido, pero el hecho de que unos creyentes 70 años más tarde actuaran como si un Cristo fuera su dios no nos dice nada sobre si Jesús fue una persona real en esta tierra.
    Mara Bar-Serapio: SIRIO Estoico (escribió después del año 73):No tenemos ninguna forma de fechar el fragmento que cita la carta de Mara Bar-Serapion. No menciona a Jesús o a Cristo, sino que simplemente dice que los judíos de la época (cuya fecha es incierta) mataron su “Sabio Rey”. Es irrelevante como una evidencia de un Jesús histórico.
    Talmudes Judíos: babilonicos (entre 100 a 500 d.C) : las autoridades han concordado en que la mayoría de este material talmúdico se deriva del período que va del 200 al 500 A.D., y que representa intentos Judíos para tratar con la creciente fortaleza del cristianismo. Por lo tanto, no es una verificación independiente de la existencia de Jesús, porque la intención era la de enfrentarse a la ideología cristiana.
    Luciano de Samosata: Satiro GRIEGO (segundo siglo) :De forma similar, el comentario sarcástico de Luciano, escrito en el siglo segundo, no sirve para nada, excepto como evidencia de que éste último sabía que los cristianos de la época (de los cuales ya había un gran número) sentían o pensaban que había un hombre “que había sido crucificado en Palestina” como la base de su secta.
    Además, esto fue escrito demasiado tarde para ser usado como evidencia histórica y ni siquiera Luciano la ofrece como tal.
    Tertuliano: (160-220):Lo que no dice es que Tertuliano está basándose (para el efecto, se supone que Tiberio había recibido un reporte de Poncio Pilatos acerca de Jesús) en Justino, y Justino está simplemente asumiendo que debe haber existido tal reporte. Posteriormente, (cerca del siglo quinto) alguien falsificó el reporte existente actualmente, conteniendo lo que se supone deberían haber sido las palabras que Pilatos hubiera enviado a Roma sobre la ejecución de Jesús.
    – Talos : (año 52 aprox.) :El testimonio (también suponiendo que hubiera existido, ya que el trabajo en cuestión se ha perdido) de Talo tampoco tiene ninguna validez para la cuestión de la historicidad de Jesús. Julio Africano, en un fragmento superviviente, afirma que Talo, en el período anterior al 221 AD., escribió que la oscuridad que supuestamente cubrió la tierra en el momento de la crucifixión fue debida a la muerte de Jesús. El simplemente está diciendo lo que los cristianos de esa época creían. No tenemos ninguna evidencia en absoluto de que hubiera habido un eclipse en el momento en que supuestamente Jesús fue crucificado. (Personalmente, creo que si hubiera existido tal oscuridad sería de carácter local).
    Justino Mártir: (100-165):Justino simplemente asumió que debía haber un reporte de Pilatos a Tiberio.
    Marco Aurelio:Creo más bien que el emperador romano habla de las persecuciones que realizó él a los cristianos. No tiene valor histórico para determinar la existencia de Cristo, pues vivió mucho antes de que el emperador naciera.
    Un saludo

  68. Walter says:

    David:
    Se dice de esta manera: Jesucristo no es un personaje histórico.
    El caso de Homero es diferente: Los libros escritos por Homero existen y los puedes leer, en cambio, no existe ningún libro escrito por Jesucristo.
    El caso de Troya y de Pompeya no son iguales, Troya sigue siendo un mito. Al menos la Troya que se relata en la Iliada; en cambio Pompeya se puede visitar.
    No es seguro que el mito de Cristo parta de una persona real, podrian ser varias personas o ninguna. Los escritos primigenios del Cristianismo no hablan de un Jesús humano sino de un hijo de Dios solo divino. Conforme avanzan los años va surgiendo la historia detallada del Jesús de los Evangelios (con muchas variantes)
    Lo que ocurre con Gordon Stein es que lo estas sacando de contexto, ya te explique que indica en que investigadores se basa. Y la confusión surge pues tu insiste en presumir que todo el martirologio cristiano esta probado por una (o dos) brevisimas menciones dudosas de dos historiadores romanos que vivieron mucho después del tiempo de Jesús. El punto central es probar que Jesús existio. La gente puede morir por cosas inexistentes, mira a los terroristas suicidas que creen que se van al cielo apenas revientan. Eso no prueba que Ala exista. Y si la gente ignorante existio antes y existe ahora si no los que negocian con la credulidad de la gente no tendrian éxito.
    Y lo que no comprendes aún es que CRISTO no es un nombre propio ES UN TITULO y es ilógico que un no creyente use el titulo de ELEGIDO para indicar a un judio revoltoso. Y repito por enésima vez, Cristos, es decir Elegidos, o Mesias habian montones por esa época. Aun si lo romanos lo dijeran con sorna, ¿como sabemos a cual de ellos se refieren?
    Las pruebas de la existencia de Cristo, eran Los Evangelios, y estan fuera por mitológicos,. Josefo y está fuera por fraude, solo quedan Tacito y Suetonio, y estan fuera pues más alla de que hablen de persecuciones a los mesianicos NO PRUEBA QUE JESUCRISTO EXISTIO.
    Entonces; no se trata de no comprender como dicen que Cristo no es histórico, lo que sorprende es ¿Cómo dicen que Jesús es histórico? ¿Cuál es la prueba? El hecho de que la religión cristiana absolutamente dominante de las mentes occidentales y con gran influencia en la historia del mundo haya impuesto esa creencia NO LA HACE VERDADERA, SE REQUIEREN PRUEBAS. Y hasta el momento no he visto ninguna, tu mismo te encargaa de desvirtuar varias de ellas que son repetidas como ciertas por los apologistas.
    Si aparecen pruebas válidas no tengo ningun problema en reconocer la existencia del hombre Jesus, asi no acepte al Dios Jesus, pero necesito pruebas.
    Saludos cordiales,
    Walter

  69. david says:

    Hola Walter:
    Concuerdo contigo en que el título de Cristo se empleaba en aquella época con mucha frecuencia.
    También en que había muchos mesías.
    Pero la pregunta es: ¿por qué a nuestros días sólo hay un culto hacía un sólo mesías judío, habiendo tantos otros en aquella época?
    En el libro “Hechos de los apóstoles” hay una referencia de un fariseo: Dejad que sigan a ese mesías, otros han surgido como Judas, etc, pero ya nadie habla de ellos.
    Lo mismo ocurrirá con Jesús.
    Lo cierto es que, habiendo desprestigiado a tantos mesías, los judíos fariseos no consiguieron hacer lo mismo con el culto a Jesús.
    Podría haber un culto al mesías Judas o al mesías Abraham.
    El caso que mencionas de los terroristas musulmanes no es lo mismo.
    Los apóstoles, conocieron a Jesús, y murieron no por una creencia de oidas, sino por algo que habían vivido.
    Evangelios:
    San Ireneo (170), obispo de Lyon. Era discípulo de Policarpo, quien a su vez era discípulo de Juan el Evangelista. S. Ireneo escribe: “Mateo escribe cuando Pedro y Pablo evangelizaban Roma, hacia el 50, en lengua hebrea; Marcos transmite la predicación de Pedro, hacia el 65; Lucas, colaborador de Pablo, escribe el evangelio enseñado por éste a los gentiles entre los años 67 y 70; Juan escribe en Efeso hacia fines del siglo primero”
    Puede ser que en ellos exista mitos o manipulaciones posteriores, pero también ocurre con la historia romana (por ejemplo, Rómulo y Remo) o las genealogías reales (Julio César se jactaba de ser descendiente de la diosa Venus.)
    En cuanto a Gordon Stein, no lo estoy desacreditando. Simplemente digo que está mal informado, y no creo que haya que fiarse mucho de él (por lo menos, plenamente).
    Estoy de acuerdo con las demás afirmaciones, excepto a la de negar la fiabilidad de Tácito y a decir que es la única cita que menciona el incendio y las persecuciones a cristianos.
    No es nada personal.
    En cuanto a las persecuciones y el incendio, está ampliamente documentado en artehistoria, y en cualquier enciclopedia seria. No quiero decir que esto sea prueba de la existencia de Jesucristo, no me malinterpretes.
    Un saludo

  70. Walter says:

    David:
    Tu pregunta parte de una premisa falsa: No solo hay un culto a un Mesías judío; hay muchísimos cultos a muchísimas deidades pero eso no prueba que sean verdaderas. Los “Hechos de los Apóstoles” son fabulas religiosss y no historia real, y “los apóstoles” son igual de míticos que Jesus. En el caso del martirologio de los islamistas, ¿porqué piensas que no es igual al cristiano? ¿su fe no vale y la tuya sí?. Es cierto que lo de Rómulo y Remo es el mismo caso que el de Jesucristo, pero no hay gente que insista sin pruebas en que Romulo y Remo sean personajes históricos, como lo haces tu en el caso de Jesucristo; si hubiera una religión Romuloremana los adeptos afirmarían que la existencia de Roma prueba que sus fundadores son personajes historicos, y dirían también, como haces tu en el caso de Jesus, que si no hubieran existido Romulo y Remo ¿como existe Roma?. En lo de Gordon Stein, no creo esté mal informado si no que no lo has entendido. En cuanto a Tácito no puedo discutir tu fe en él. Respecto a “las persecuciones romanas” Antehistoria, que tu citas, dice: “la propaganda cristiana de la Iglesia triunfante posterior ha desorbitado los hechos al presentar esta primera persecución como el modelo de todas las posteriores, como si el Estado romano persiguiera sistemáticamente a los cristianos y como si cada persecución hubiera sido una simple e indiscriminada aplicación de condenas sin juicios previos; tal visión errónea encuentra aún muchos seguidores.” Y no es que te malinterprete, pero si tu mismo aceptas que Tácito NO prueba que Jesucristo existió, ¿para qué llevas el debate a esos aspectos absolutamente secundarios?
    Atentamente,
    Walter

  71. nestor rafael says:

    lo que pasa walter es que ni la creacion ni la evolucion nos dan por sentado que las cosas provinieron tal y como nos las explican cada una. me aconsejastes que citara tal pagina para que lellera acerca del origen de la vida y te aseguro que no encontre nada interesante por lo que esas teorias ya las ley y no parecen las explicaciones correctas para definir un misterio tan grande que es la vida. sin enbargo fijate en algo walter, es cierto que la ciencia respondera a muchas mas cosas que hoy nos preguntamos y creo que una de esas es el origen de la vida por que todavia estamos lejos de saberla.. creo walter que la respuesta esta en el espacio infinito que observamos todos las noches. el hombre tiene deseos de conocer otros planetas y crear vida ahi, como por ejemplo marte principal objetivo de conquista para el hombre y solamente en esos lugares, que no tiene que ser necesariamente marte o un laboratorio en la tierra por que ya an fracasado en los laboratorios, si no tambien en otros planetas con condiciones aptas para el desarrollo de la vida. se que lo que digo es bastante utopico pero por lo que vemos es este el camino que rrecore la ciencia en todo su conjunto. en las proximas opiniones planteare mis argumentos de forma mas explicitas y extensas

  72. Walter says:

    Hola Nestor Rafael:
    Me parecen muy interesantes tus opiniones y comparto tu deseo de buscar la explcacion del origen de la vida. A continuación te voy a transcribir algunos conceptos que ayudaran a clarificar nuestro dialogo.
    Evolucion y Creacion
    “Los creacionistas afirman que sólo existen dos explicaciones para el origen de la vida: Creación o Evolución. Sin embargo ellos no incluyen las explicaciones míticas de los pueblos indígenas, ni las de otras culturas. Arrogantemente las califican como mitos. ¿Acaso la historia de Adán y Eva en un paraíso y tentados por una serpiente parlanchina no lo es? Los fundamentalistas alegaban también que la creación es una explicación científica alterna y que tanto la teoría de Darwin como la de “Moisés” deberían enseñarse por igual en las aulas de clase. La aprobación de esta ley la consiguieron, pero duraría muy corto tiempo.
    Los científicos estaban horrorizados: ¿Qué vendría después? ¿Intentarían entonces los astrólogos apelar por un “trato igualitario” con la astronomía? ¿Cumpliría la arrogante pseudociencia de la creación permear las escuelas?
    El polvorín explotó en 1982 cuando la “American Civil Liberties Union” demandó la ley del “trato equilibrado” por considerarla como la imposición religiosa de un dogma en particular. Un equipo voluntario de juristas recorrió el país del Norte buscando testigos especializados en Ciencia, Filosofía de la Ciencia y Teología.
    Durante las audiencias que se continuaron, los científicos explicaron en el tribunal cómo un sinnúmero de evidencias sustentaba la Evolución:
    * la Embriología,
    * la Anatomía comparada,
    * la Paleontología,
    * la Geología,
    * la Genética,
    * la Bioquímica,
    * la Biogeografía, etc.
    En cambio la “ciencia creacionista” sólo apelaba a:
    * la firme convicción de creer en la “palabra de Dios”, sin pedir evidencias.
    El juez terminó por darle la razón a la parte demandante (cientificos) y dentro de su fallo de 38 páginas dejó claras las características de la ciencia (algo nunca antes hecho en un tribunal, lo que constituye un hito en la historia de la Ciencia moderna).
    Tales características, a su juicio, son:
    1. Se guía por las leyes de la naturaleza.
    2. Ha de ser explicativa en lo que se refiere a las leyes de la naturaleza.
    3. Es comprobable frente a los hechos empíricos.
    4. Sus conclusiones son provisionales, es decir no son necesariamente la última palabra (una teoría es reemplazada por otra cuando aparece una explicación con evidencias más reveladoras, por lo tanto en Ciencia no hay verdades absolutas, ni temas incuestionables como ocurre en la religión).
    5. Los hechos científicos deben ser capaces de superar los que intentan refutarlos (por más de un siglo y medio la Evolución ha demostrado ser un hecho real de la naturaleza de los seres vivos, con tanta validez como la esfericidad de la Tierra).
    El juez también sentenció que
    la “ciencia de la creación” (o creacionismo científico, como también se conoce) no puede considerarse una explicación científica, ya que sólo se trata de un dogma religioso y no está respaldado por evidencias.”
    http://www.geocities.com/escepticoscolombia/articulos/creacionismo/cientribunal.html
    Como ves la ciencia no se encarga de
    El origen extraterrestre de la vida
    Aunque no como teoría científica, pero si a nivel de hipótesis existe la idea de la “Panspermia” que propone la formación de la vida en la Tierra como producto de bacterias venidas a la Tierra en meteoritos que impactaron hace unos 4,000 millones de años. Esta idea fue apoyada por ejemplo por el astronomo Fred Hoyle. El análisis del meteorito ALH84001, generalmente considerado como originado en el planeta Marte, sugiere que contiene estructuras que podrían haber sido causadas por formas de vida microscópica. Esta es hasta la fecha la única indicación de vida extraterrestre y aún es muy controvertida. Por ejemplo en http://www.biocab.org (Biology Cabinet) dice:
    “Cuándo el químico S. A. Arrhenius propuso su hipótesis sobre la ascendencia cósmica de la vida, él eludió, en vez de elucidar, el problema del origen espontáneo de los primeros seres vivientes.
    Como lo he dicho antes (ciencia), una teoría es válida solo para un lugar y un tiempo definido, y el hecho de que en el presente la vida no se genere por procesos abióticos, no significa que la vida no pudo originarse espontáneamente en otro tiempo y en otro lugar.
    No permita que Lovelock, Hoyle y Wickramasinghe lo engañen, y no se engañe: junto con los informes panspermistas, la hipótesis de la ascendencia cósmica se ha asociado íntimamente con la fe, la filosofía y la religión. Para ellos existe un poder misterioso que se dedica a “esparcir” la vida por todo el universo. Vea cómo lo habían ocultado, pero ahora, ellos revelan su real intención.
    Las formas vivientes más primitivas se engendraron espontáneamente en la Tierra mediante procesos abióticos, sin alguna intervención sobrenatural. Toda la “evidencia” acumulada que alegan los panspermistas en su versión, no es evidencia que favorezca a la ascendencia cósmica de la vida terrestre, sino apenas como una especulación sobre cómo la vida pudo alcanzar la Tierra si la vida vino de otros lugares cósmicos. No hay un sustento real a favor de la panspermia (Por favor lea el Apéndice # 1).
    Usted debe saber que los panspermistas asumen que la vida no tuvo un principio (imagine tal desconcierto), al contrario ellos piensa que la vida es infinita en el tiempo. Es decir, que la vida ha existido perpetuamente, que la vida es eterna ¿No huele la panspermia a Creacionismo?
    El modelo evolutivo del Origen de la Vida elucida su origen tanto en la Tierra como en cualquier parte del Cosmos. Por el contrario, la panspermia no explica el origen de la vida en ningún lugar: ni aquí, ni allá. Para ir al grano, la hipótesis de la panspermia se aleja del significado fundamental de la ciencia: obtener la verdad y dar explicaciones veraces a los acontecimientos naturales.”
    http://www.biocab.org/Panspermia_esp.html
    Saludos,
    Walter
    Nota: Se escribe “leyera” y no “lellera”; “leí” y no “ley”, “sin embargo” y no “sin embargo”. Para que mejores tu ortografia (aún si son errores tipograficos) te recomiendo que escribas tus textos en Word que tiene corrector automático de ortografía, ayuda mucho. ¡Ah¡ y disculpa mi atrevimiento, no es por pontificar sino por ayudar. Siempre se puede aprender más.

  73. Walter says:

    Hola David:
    En mi cita de Wikipedia en ingles sobre Tacitus, se menciona erroneamente a “H.G. Wells”, en lugar de “G.A. Wells”. El error venia de Wikipedia y como es una Enclopedia abierta, hice la corrección (primera vez que lo hago, ojala la acepten).
    Walter

  74. Walter says:

    Nestor:
    Fe de Erratas: Deje incompleto un párrafo en que quería decir ‘La ciencia no se ocupa de lo utópico sino de lo verificable’. Tambien en la Nota debia decir ‘Se escribe “sin embargo” y no “sin enbargo”‘
    Walter

  75. david says:

    Hola Walter:
    La pregunta era: ¿Por qué tan sólo existe hoy en día un culto para sólo un mesías JUDÍO?
    Existieron muchos falsos mesías de origen judío (había uno, incluso en la edad media, que acabó convirtiendose al islam),pero hoy, siglo XXI, nadie le honra ni le da culto.
    En Asia, por ejemplo, existe el culto a varios “mesías”. Buda, Krhisna, Hanuman, (por citar unos pocos).
    Tengo entendido que los evangelios (en especial los sinópticos)proceden de una fuente común (llámese documento Q).
    Los evangelios (aunque creo que no como los conocemos hoy en día), fueron redactados por discípulos directos de Jesús.
    Dijiste, (no sé si te malinterpreto, y si lo hago te pido perdón), que la prueba o posibilidad de que Homero existiera es que escribió la Ilíada y la Odisea.
    Si esto es así, por lo menos podemos asegurar hasta un cierto punto, que los apóstoles existieron.
    No quise decir que la fe de los islámicos no es válida. Dije que los apóstoles murieron por algo que habían vivido, visto y oido por sí mismos.
    Los terroristas islámicos, dudo que hayan visto por sí mismos a Alá.
    Estoy de acuerdo con lo que mencionas de “artehistoria”, se exageró el número de víctimas (cuando en Roma en aquella época los cristianos eran una minoría) y que esto se ha usado como publicidad cristiana. Sin embargo, no niega que el incendio y las persecuciones existieran.
    En cuanto a Tácito, yo pienso que si muestra que Jesús existió, ya que es mucha casualidad que el mesías que adoraban los cristianos fuese también crucificado por Poncio Pilatos y en la misma época.
    Un saludo
    PD1: No sé que entiendes tú por mitología, el libro “Hechos de los apóstoles” sólo narra las crónicas y la sociedad de aquella época. (tal vez te refieras a los milagros u otra cosa simbólica que en el se narra).
    PD2: Me extrañó ver a “H. G. Wells”, pensé que a lo mejor había escrito algo de historia.

  76. david says:

    Hola Walter y Nestor Rafael:
    El mito, según nos enseñó Platón, es una forma figurada de acceso al “logos”, un modo de hacer accesible a la inteligencia lo que por su naturaleza es misterioso o impenetrable.
    En la época en que fue escrita la Biblia, no existía los conocimientos científicos con los que contamos hoy.
    Los hebreos (al igual que los griegos, los hindúes o cualquier otra cultura), intentaron explicar el origen del cosmos.
    Era un acercamiento al “logos”.
    Por emplear un mito, no quiere decir que sean ignorantes, sino todo lo contrario.
    En cuanto al relato del Génesis, se podría decir que es una narración “desmitificadora”.
    Los elementos no son considerados aqui como dioses (al contrario que las religiones babilónicas). Dios es considerado como el motor que todo lo mueve y crea, separado de su creación.
    Los griegos que murieron en Grecia por decir que el sol no era un dios, no hubieran corrido la misma suerte en Israel.
    También añadir que éste relato debe tomarse alegóricamente.
    No se puede tomar en serio los 6 días de Creación, ni que las plantas aparecieran antes que el sol, ni que la tierra sea más anciana que l universo.
    Un saludo

  77. Walter says:

    David:
    Te respondí así: La persistencia de una creencia no es prueba de que el objeto de su culto sea verdadero. Si quieres saber porque y como triunfó el mítico mesianismo de Jesús; como absorbió a las otras leyendas mesiánicas y a los otros Mesías; y sobre la formación paulatina de su dogma en base a la fusión de creencias helénicas y orientales con las judías; pues lee la historia del Imperio romano.
    Lo de los Apóstoles y Homero no es lo mismo. Homero es autor (sea quien fuere) y no protagonista de su propia obra. Nadie dice, que la Iliada es histórica porque la escribió Homero y que Homero es histórico por que lo dice la Iliada. En el caso de los “apóstoles” eso es lo que estas afirmando: “Los evangelios son históricos porque los escribieron los apóstoles”; y: “Los apóstoles son históricos porque esta escrito en los evangelios”. Y lo de la autoría apostólica es históricamente inexacta; como ya entraste en la hagiografía neotestamentaria investiga quienes se supone que escribieron los evangelios. Veras que no son “los apóstoles”.
    MITO: 1. m. Narración maravillosa situada fuera del tiempo histórico y protagonizada por personajes de carácter divino o heroico. Con frecuencia interpreta el origen del mundo o grandes acontecimientos de la humanidad. 2. m. Historia ficticia o personaje literario o artístico que condensa alguna realidad humana de significación universal. RAE/
    En los siguientes puntos me gustaría que elaboraras más si deseas que opine, pues el simple enunciado no me dice nada:
    1) ¿Cómo es que el mito sirve para “conocer lo inconocible”?
    2) ¿Porque seguir creyendo en las explicaciones obsoletas de la Biblia?
    3) ¿Qué desmitifica el Génesis y cómo?
    4) ¿Qué entiendes por Logos? (no Platón, sino tu)
    5) ¿De qué elementos hablas?
    6) ¿De qué dios motor hablas?
    7) ¿Afirmas que los griegos eran más intolerantes que los Israelitas?
    8) ¿Afirmas que los judíos no mataban a los herejes?
    9) ¿Como decides qué relatos de la Biblia son alegóricos y cuáles son históricos?
    Y, por favor, no volvamos a los temas que ya tratamos en otro foro pues sería tentar a la maligna deidad local (el diabólico Junjan), quien en su limitado ancho de banda, y no mayor paciencia, puede cancelarnos si escucha burbujeos de besugos. :-)
    Chau,
    Walter
    Nota: “Ignorante” significa “que no tiene noticia de algo”; yo soy ignorante en muchos temas y por eso vengo aquí a desasnarme un poco. Y aunque no acepte a veces las explicaciones ajenas, siempre me motivan a investigar y a aprender más. En ese sentido: ¿Porque aferrarnos a las explicaciones de un libro escrito por gente ignorante de hace 2,000 años? ES MITOLOGIA NO ES CONOCIMIENTO.

  78. david says:

    Hola Walter:
    Tus preguntas:
    1) ¿Cómo es que el mito sirve para “conocer lo inconocible”?
    Los pueblos primitivos, no tenían conocimientos acerca de muchos fenómenos naturales (no sabían como se originaba la lluvia, como el sol aparecía y desaparecía, por qué nevaba, etc), por lo que se dedicaron a explicar tales cuestiones mediante fuerzas sobrenaturales, divinidades, etc. El mito es otra forma de pensar, cercana a la filosofía. Intenta dar explicaciones a lo que no se conoce (por lo que intenta “conocer lo inconocible”)
    2) ¿Porque seguir creyendo en las explicaciones obsoletas de la Biblia?
    No digo que haya que seguir creyendo en tales explicaciones, sino tomarlas alegóricamente, no científicamente.
    3) ¿Qué desmitifica el Génesis y cómo?
    El Génesis desmitifica a otras mitologías. Por ejemplo, la mitología griega.
    En esta mitología se dice que el Sol (elios), el cielo (Urano), la Tierra (Gea), etc; eran dioses personales y humanoides.
    Lo mismo pasa con otras mitologías, por ejemplo la babilónica.
    El Génesis presenta una deidad abstracta que con su sola palabra da existencia al universo (se podría comparar con el Big Bang).
    4) ¿Qué entiendes por Logos? (no Platón, sino tu)
    Entiendo por Logos, una explicación accesible para la mente humana, simple, sin recurrir a fuerzas sobrehumanas.
    Es lo que se conoce como “La Navaja de Occam” “No se deben multiplicar entidades, a menos que sea necesario”.
    Dicho con otras palabras, quiere decir que uno debe utilizar una explicación simple, basada en premisas simples; antes de hacer una explicación compleja.
    5) ¿De qué elementos hablas?
    Cuando mencioné a los elementos, me refería a las estrellas, sol, luna, la tierra, el mar, el cielo, etc.
    6) ¿De qué dios motor hablas?
    Lo he citado anteriormente.
    7) ¿Afirmas que los griegos eran más intolerantes que los Israelitas?
    8) ¿Afirmas que los judíos no mataban a los herejes?
    No estoy afirmando nada de eso. Lo que yo afirmo es que los judíos no creían que el sol, el cielo, el mar, etc; fuesen dioses. Por lo tanto, los griegos que fueron asesinados por decir que el sol no era una divinidad, no hubieran sufrido esa misma suerte en Israel.
    Los israelitas si mataban a herejes, pero no por tales afirmaciones.
    9) ¿Como decides qué relatos de la Biblia son alegóricos y cuáles son históricos?
    Creo que está claro.
    Los pasajes que intentan explicar el origen del Cosmos, del ser humano y de la entrada del pecado al mundo, son alegóricos.
    Los pasajes que sólo narran unos hechos que se dieron en determinados lugares, se pueden considerar como históricos.
    Por ejemplo, los libros 1 y 2 de Samuel, que se adelantan a Herodoto en varios siglos.
    Para mi, la mitología, tomada alegóricamente, SI ES CONOCIMIENTO.
    ________
    Los apóstoles: coincido contigo, en que los evangelios, tal como los conocemos hoy en día no fueron escritos por los apóstoles. Sin embargo, se cree que existe un documento original (documento Q), del cual surgen los evangelios sinópticos.
    También se dice que los evangelios, aunque no fueran escritos por los apóstoles, si contienen datos de ellos que se dieron de primera mano.
    Un saludo

  79. david says:

    Hola de nuevo:
    En cuanto a la historia del imperio romano, creo que hablas de la persistencia del culto cristiano, pero no que durante la conversión de Constantino se crease la persona de Jesús (o dogma, si lo prefieres).
    Si leemos las epístolas del apóstol Pablo de Tarso, que fueron muy anteriores al nacimiento de Constantino,vemos que ya existía la figura mesiánica de Jesús. Luego no creo que la historia del imperio romano explique la aparición de esta persona.
    Soy consciente de que la religión cristiana tiene elementos prestados de otras religiones o cultos (griega, orfismo,etc), pero ello no prueba nada.
    Un saludo

  80. Walter says:

    Por eso, David, lee la historia para que entiendas. Si no lo crees es porque lees mitos en lugar de historia. No es cuestión de simpatias o antipatias, es cuestión de saber la verdad.
    Walter

  81. david says:

    Hola Walter:
    Respecto a tu último comentario: ¿qué es lo que no creo?
    Tal vez te refieras a que Jesús no es producto del imperio romano.
    Jesús aparece ya en las epístolas de Pablo, muy anteriores al nacimiento de Constantino. Y esto no es mitología, es historia.

  82. david says:

    Una cosa es la persona o nombre de Jesús (sea o no un personaje histórico) y otra distinta la iglesia o culto que surgió posteriormente.

  83. Walter says:

    Bueno David:
    Lo que no crees, según tu propia afirmación, es que sea útil “aprender la historia romana para conocer el origen del cristianismo” y que te basta creer lo que dicen unas composiciones literarias en estilo epistolar (no son cartas realmente) de un Saulo de Tarso cuyo autenticidad es dudosa y su contenido es solo místico; que nunca habla de un Jesucristo histórico ni menciona nada de su vida, y afirmas que prefieres esa fuente religiosa pese a que reconoces que Pablo ¡tampoco conoció a Jesús!. ¿Quien lo conoció realmente?
    Igualmente tus afirmaciones de que “la mitología permite conocer lo inconocible” son una absurda contradicción, lo “inconocible” por su propia definición “no puede conocerse”.
    Y si eres conciente de que el cristianismo contiene elementos de otras religiones, ¿Cómo puede afirmar a continuación que eso no prueba, nada? Por supuesto que prueba mucho, si la mitologia judía mesiánica se fusionó con las religiones helénicas, mito de Dioniso, con las egipcias, Isis, persas, misterios eleusinos, etc. aglutinando así por concenso a diferentes sectores del imperio romano; es absolutamente probatorio de que el cristianismo, no surgio directamente de las enseñanzas de ningun Cristo de carne y hueso, sino que es producto de esa mescolanza de credos de su época, acomodada a conveniencia por los lideres religiosos con el fin de captar adeptos. (Ver cita mas abajo)
    Tus siguientes respuestas me parecieron insuficientes:
    ¿Como es que el Genesis que es un Mito puede “desmitificar” otros Mitos?¿Con tu “desmitificación” dejan de ser mitos, el Genesis o los otros?
    ¿Te parece equivalente el Mito del Genesis a la Teoria del Big Bang? ¿Ambos explican por igual el origen del Universo?¿Es una ciencia el creacionismo?
    Respecto al “Logos” y la “razuradora de Occam” ¿Te parece que es “simple” explicar el origen del Universo con la intervención un SER INEXPLICABLE? el recurso de un Dios inexplicable en realidad es una “NO EXPLICACION” y recuerda que el principio se aplica a la ciencia y no a la religión.
    ¿Estas seguro que solo porque la Bilblia “narre hechos ocurridos en determinados lugares” SON HECHOS HISTORICOS? ¿No hay necesidad de corroboración con otras fuentes?¿No hay necesidad de verificaciones arqueologicas? Puede ser que estes confundiendo también el término y entiendas “historia” en su válida acepción de cuentos, como en “no me vengas con historias”; yo en cambio hablo de la Ciencia Social llamada Historia; con mayúsuculas, que estudia los acontecimientos pasados en base a pruebas.
    Sobre tus lineas que contienen, “se dice” y “se cree”. Al menos debías decir quien dice y quien cree, para ver su confiabilidad en el tema.
    Tu definicion de mito no es la que tiene el diccionario, donde “mito” se define como “narracion maravillosa” e “historia ficticia”, y no discrepo contigo en que sea bueno conocer la mitología de los pueblos, pero lo que no es bueno es confundir el conocimiento de la mitología con el conocimeinto de la historia, que es el conocimiento que estamos tratando. Yo acepto el Mito Jesus, no acepto el Jesus histórico. Al menos mientras no encuentre pruebas razonables.
    Y aqui algo de historia:
    Fuentes históricas del Cristianismo
    ERNESTO GUEVARA FLORES
    Historiador
    http://www.geocities.com/
    Athens/Olympus/9234/guevara.htm
    El documento literario cristiano más antiguo es el Apocalipsis de Juan, del 68-59 d.c. hecho por un Juan de la isla de Patmos, uno de los profetas de la venida del Mesías. Juan se dirige a las siete ekklesías [comunidades] de Asia Menor que esperan la llegada de Cristo pero llamándolos aún judíos y todavía no cristianos.
    Aquí Juan cuenta visiones reveladas del ”fin del mundo” próximo y del ”juicio final” que haría Cristo ”el cordero de Dios” al mundo pecador y sobre todo a la ciudad de Babilonia, una gran prostituta (Roma) sentada sobre un animal de siete cabezas (los emperadores) que le hace la guerra a los ”santos”, es decir los creyentes; Cristo al frente de un ejército de justos, precipita al animal y sus secuaces en la hoguera de la gehena [castigo] creando luego un nuevo cielo y una nueva Tierra, construyendo la nueva Jerusalén, y resucitando los justos a la vida eterna en un reinado bienaventurado de Cristo sin fin.
    El Apocalipsis es el libro de lenguaje más oscuro y esotérico del Nuevo Testamento, pero por su acento guerrero y apasionado de lucha por la supervivencia religiosa, estaba claramente destinado a reafirmar la fe en el Asia Menor romana en tiempos de persecución, usando recursos de la tradición profética judía. A partir de aquí, este Euanggeliôn (‘Buena Nueva’ en griego) del próximo advenimiento del Salvador fue extendida por emigrantes, esclavos capturados, peregrinos y sobre todo por apóstolôs [‘enviados’ en griego, seguidores que difunden y propagandizan la doctrina de Jesús]; siendo favorablemente acogida por esclavos, pobres, afligidos y sobre todo por las mujeres. Todos los sectores no romanos desfavorecidos por la dominación romana, pero también por los estados asiáticos y orientales.
    A estas primeras comunidades cristianas se les llama, en términos históricos y sobre todo artísticos, Epoca Paleocristiana. A su vez, estas comunidades, al tener asambleas religiosas, reciben el nombre griego de ekklesias. De aquí se genera el nombre Iglesia, de vital importancia para el cristianismo posterior. Simple grupo judío al inicio, el movimiento adquirió un carácter masivo, primero en las provincias orientales de lengua griega, como Asia Menor y Egipto; y luego en las provincias occidentales romanas de Europa Mediterránea. Para el siglo II d.c. surgió una literatura oral y luego escrita , en hebrero pero sobre todo en griego, de sermones, epístoles [cartas] y ”revelaciones”, obras llenas de leyendas y mitos, que las iglesias intercambiaban.
    Del 100 al 130 d.c. se formó y extendió entre los creyentes en Cristo (cristianos, como empezaron a llamarse) el mito de que Cristo, ”rey de los cielos” había venido ya a la Tierra en la forma de un hombre humilde llamado Jesús de Nazaret (pueblo palestino) sufriendo en persona todos los sufrimientos de los pobres. Sobre esto se compusieron multitud de Evangelios [Buenas Nuevas], cuatro de los cuales, llamados canónicos [del griego kanôn o regla), son los más aceptados: los de Marcos, Mateo, Lucas y Juan. Los tres primeros son llamados evangelios sinópticos, por la unidad de exposición que permite la comparación simultánea.
    Ni el más grande historiador romano Cornelio Tácito en sus Anales y en Historias (que cubren del 55 al 120 dc en 16 libros), ni en Vidas Paralelas del griego Plutarco o el romano Suetonio en Vidas de los Doce Césares; ni en la Historia romana del asiático Apiano (24 libros), que escribe en griego a mediados del siglo III. La Historia Romana (80 libros) del griego Dión Casio tampoco contiene datos al respecto. Todos ellos narraron la historia de la expansión romana en Asia Menor, incluida Judea y Palestina.
    En el siglo V dc el sacerdote Paulo Orosio escribió su Historia Universal desde Adán hasta el año 410 dc, (Historia en siete libros contra los paganos) alabando el reino de Dios cristiano como oposición al paganismo previo. En estas obras, hechas con espíritu cristiano, se habla del Hijo de Dios, de las comunidades cristianas y del Apocalipsis, de la fe cristiana y del evangelio; pero en relación al mundo romano, y sin mencionar a Jesús como el Cristo referido arriba.
    Desde sus orígenes la religión del cristianismo enseñaba resignación, apartando a numerosa población pobre de la sociedad romana (es decir la totalidad del Imperio) de formas concretas de participación contra el dominio romano. La historia posterior del cristianismo muestra que dejó de ser una religión de los pueblos asiáticos dominados por Roma, de esclavos y empobrecidos, convirtiéndose en una religión como las demás instrumento de influencia dominante. Al no llegar Cristo, las esperanzas mesiánicas se debilitaron y esto generó un fenómeno histórico fundamental: el cambio de la composición social de las iglesias. Los ricos y poderosos romanos y asiáticos empezaron a hacerse cristianos, colmando las comunidades con donativos e incluso convirtiéndose en santos patronos de iglesias cristianas enteras. Es el caso de la gran familia patricia de los Metelo, o Marcia la cortesana del emperador Cómodo.
    Esta evolución se acentuó el el siglo II e inicios del III, sufriendo las iglesias cristianas una transformación profunda. Algunas se convirtieron en propietarias de herencias, casas de alquiler, tesoros y dinero; y ser sacerdote se volvió una profesión. La obra Sobre la muerte de Peregrino de Luciano de Samosata (escritor sofista griego del siglo II de fina ironía, autor de obras satíricas) muestra a aventureros y ladrones haciéndose nombrar para el cargo de sacerdote y explotando la credulidad de las gentes sencillas. En los sermones se oyó la nueva idea de que los esclavos debían ser sumisos porque todo poder emana de Dios. El nuevo tipo de dignatario, el obispos [prelado con poder para gobernar una iglesia] vigilaba las metrópolis [cabeceras de región] en obispados que se convirtieron en residencia de esta suprema autoridad religiosa.
    Al comenzar a disfrutar de una autoridad especial, los obispos de Alejandría, Antioquía y Roma iniciaron la multiplicación de complicados ritos cristianos, tomados de otras religiones. El bautismo y la comunión se convirtieron en ”misterios” iguales a los de los adoradores de Cibeles y Adonis. El culto mitríaco dio la base de la leyenda del nacimiento de Cristo en una cueva. La vulgarización de las doctrinas paleocristianas y en particular de Séneca (el padrino del cristianismo) estableció un sistema ético cristiano basado en la humildad y la paciencia. Filón el Hebreo, escritos egipcio del siglo I, llamado ”el padre del cristianismo” realizó el sincretismo del judaísmo con la filosofía griega, inspirando el siglo II la doctrina cristiana del logos [el ‘verbo’] y sobre todo la de los ággelos [en griego mensajeros]. Los ángeles eran considerados espíritus celestiales en varias religiones, creados por la divinidad para su servicio y para mediar con los mortales. Es un claro ángel el Shedu babilónico, el Amesha zoroastrista, el Hermes griego, y los de los antiguos textos hebreos. El cristianismo retomó esta figura.” Ernesto Guevara F, Historiador.
    Walter

  84. Walter says:

    David cuando lanzaste tu slogan publicitario “Dios es Amor”, mencionaste a la Madre Teresa de Calcuta, como símbolo de amor. Para que veas como se forman los mitos, en Wikipedia, contrariamente a la opinión no informada de las mayorías dice:
    An Indian-born writer living in Britain, Dr. Aroup Chatterjee, who had briefly worked in one of Mother Teresa’s homes, began investigations into the finances and other practices of Teresa’s order. In November 1992, a British journalist, Christopher Hitchens, published an article in the US left-wing journal, The Nation entitled “The Ghoul of Calcutta” criticizing Mother Teresa. In 1994, Hitchens and British journalist Tariq Ali produced a critical TV documentary for the UK’s Channel 4, which was entitled Hell’s Angel, based on Chatterjee’s work. Chatterjee has been critical of what he called the “sensationalist” approach of the film, without disputing its conclusions.
    The next year, Hitchens published The Missionary Position: Mother Teresa in Theory and Practice, which repeated many of the accusations in the documentary. Chatterjee himself published The Final Verdict in 2003, a less polemic work than those of Hitchens and Ali, but equally critical of Teresa’s operations.
    Neither Mother Teresa nor the Vatican has ever revealed how much money her order received, nor what it was spent on; estimates range into the hundreds of millions of dollars[citation needed]. Hitchens alleged that Teresa was glad to suggest to donors that the money went to aid and the building of healthcare facilities for the poor in India and elsewhere, while evidence points instead to it being spent largely on missionary work in Africa, with large funds at Teresa’s discretion. No hospitals were ever built.”
    Walter

  85. david says:

    Hola Walter:
    Las diversas epístolas componen los primeros escritos del Nuevo Testamento. Algunas de ellas pudieron redactarse en fecha tan temprana como el 50 dC, casi veinte años antes de que el primero de los evangelios que ahora poseemos alcanzara su forma actual, y tal vez cincuenta años antes de que se escribiera el cuarto.
    Se supone, pues, que Juan salió de Éfeso y marchó a Patmos, ya fuese huyendo de la persecución o llevado al cautiverio en los últimos años de Domiciano, y que volvió a Éfeso tras la muerte de ese emperador, cuando el acceso al trono del benigno Nerva puso fin al momento crítico anticristiano. Como Domiciano fue asesinado en el 96, el Apocalipsis debió de escribirse en el 95.
    El nombre de Jesús, ya es mencionado. Ya existe el culto a un mesías llamado Jesús. Y todo ello muy anterior a que el imperio romano adoptara el culto cristiano.
    La religión o culto es otra cuestión, y me refiero a la transmigración de las almas, la idolatría a las imágenes, el papado, la eucaristía, las procesiones, el exorcismo, la veneración de reliquias, el dogma de la virginidad de María, el purgatorio, el limbo, el cielo, el infierno, la extremaunción, el bautismo a menores, el celibato, y un largo etc.
    Luego partes de unas premisas falsas.
    El mito (no lo digo yo, lo dice Platón)es una forma FIGURADA de acceso al “logos”.
    Nos acerca al “logos”, los mitos relativos al origen del ser humano, la entrada del mal, el origen del Cosmos, etc.
    Las leyendas que narran las hazañas de un héroe local, no son acercamientos al logos.
    ¿Como es que el Genesis que es un Mito puede “desmitificar” otros Mitos?¿Con tu “desmitificación” dejan de ser mitos, el Genesis o los otros?
    ¿Te parece equivalente el Mito del Genesis a la Teoria del Big Bang? ¿Ambos explican por igual el origen del Universo?¿Es una ciencia el creacionismo?”
    No digo que la explicación del Génesis sea análoga a la de la ciencia, sólo digo que tomandolo alegóricamente se puede comparar con el gran estallido.
    El Génesis es un mito, pero si lo comparamos con otras mitologías, resulta desmitificadora. Concibe a Dios como el primer motor, (una deidad abstracta), al igual que Aristóteles y los filósofos de la Ilustración. No deja de ser un mito ni el Génesis, ni las otras mitologías.
    Por otro lado, no pienso que el Génesis nos de la misma explicación que la ciencia, la ciencia que hoy en día poseemos nos puede ayudar a profundizar este conocimiento.
    El creacionismo no es una ciencia (los creacionistas niegan la evolución de las especies, por ejemplo), la ciencia necesita experimentos para su demostración.
    Yo, personalmente, concibo el creacionismo como la idea de que la causa de la existencia del mundo es Dios.
    La Navaja de Occam y el logos: me parece simple, decir que hubo un primer motor (llamalo dios, leyes físicas, como quieras). Tampoco quise decir que ese dios motor fuera Jehová, Yahvé, Alá, etc.
    Puede ser el dios de Einstein o de Spinoza, no tengo problema en ello.
    Un saludo

  86. david says:

    En cuanto a la Madre Teresa de Calcuta, no sé si será verdad lo que afirma tú artículo. Yo simplemente apoyaba esa frase. Apoyo la idea de la frase, pero soy consciente de que Teresa era un ser humano con todas sus equivocaciones, errores y debilidades.
    Tengo más frases que definen al amor:
    “All you need is love” John Lennon, cantante
    “Si amáis tan sólo a los que os aman, ¿qué mérito obtendréis? Incluso los pecadores lo hacen” Jesucristo
    “No hay mayor amor que aquel que da su vida por sus seres queridos” Jesucristo
    “Ama a tu prójimo como a ti mismo. Esto es toda la Torá. Lo demás es un comentario de sí misma” Rabbí Hillel
    “Ama y haz lo que quieras” Agustín de Hipona, teólogo y pensador medieval
    “Solo es capaz de comprenderlo todo el que es capaz de amarlo todo.” Marañon
    “Es una locura amar, a menos de que se ame con locura.”
    Proverbio latino
    “La gente se arregla todos los días el cabello. ¿Por qué no el corazón?”
    Proverbio chino
    “En el amor siempre hay algo de locura, mas en la locura siempre hay algo de razón.” Nietzsche
    “El que no ama ya esta muerto.” Schopenhauer
    “-El conocimiento del verdadero amor al prójimo lo debo a la conversación que oí entre 2 aldeanos:
    -Dime, amigo Iván, ¿me amas?
    -Te amo mucho.
    -¿Sabes, amigo, lo que me duele?
    -¿Cómo puedo saber lo que te duele?
    -Si no sabes lo que me duele, ¿cómo puedes decir que me amas?
    ¿Comprendes ahora? El amor, el verdadero amor, consiste en saber lo que le duele al otro.”
    (Mística de los Hasidim)
    Eso es lo que hay
    Un saludo

  87. david says:

    Relatos mitologicos:
    Génesis:
    1. Creación
    2.Adán y Eva
    3. Entrada del pecado al mundo
    4.Caín y Abel
    5. El Diluvio universal
    6. La torre de Babel
    7. El relato del libro de Jonás también lo considero una alegoría
    Leyendas:
    1. Patriarcado
    2.Éxodo
    Historia:
    1.Conquista de Canáan
    2. Período de los jueces
    (aunque estos textos están mezclados con la épica, al igual que el Cantar de Mío Cid)
    3. Monarquías
    4. Guerras con países vecinos
    5. División de Israel en dos estados
    6. Exilio en Babilonia
    (aunque ya comentamos en otro blog que el libro de Daniel tiene ciertos anacronismos, como la fecha de conquista de Jerusalén por parte de Nabucodonosor).
    7. Período profético (la narración de las visiones que tuvieron los profetas deben entenderse alegóricamente)
    8. Conquista asiria
    9. Conquista persa
    10. Conquista romana
    Un saludo

  88. Walter says:

    David:
    Se que te encanta hablar de esoterismo y de suposiciones imaginarias, pero lamentablemente a mi no. El único campo en que podemos tener un dialogo provechoso es en el campo del racionalismo y de la historia secular.
    Tampoco creo que podamos llegar a nada intercambiando frases celebres (las hay para todos los gustos), ni con suposiciones carentes de pruebas, menos aún desviando el diálogo al campo de la poesía cuando se carece de argumentos racionales.
    En lo de tu terca cursilería sobre el “amor”, es una propaganda para dar limosna a los pobres, un elogio de la caridad. Más importante es buscar que haya igualdad y justicia, para que nadie tenga que vivir de la caridad ajena, ni dependiendo de tu cantaleteado amor.
    Por eso, me da verguenza ajena leer tus sensiblerias sobre el amor, además aún en el caso sea un amor platónico a los demás (no se como se pueden amar dos que se odian por más cristianos que sean) son cosas que no se andan proclamando, como diciendo, ¡Mira, soy muy bueno, quiero el amor en el mundo!, Eso mi querido David, son DECLARACIONES DE REYNA DE BELLEZA. Por eso hablo de cursileria, porque no se dice, my friend, se siente y se practica, no se pregona.
    Walter

  89. david says:

    Walter: lo que hablo no es esoterismo ni suposiciones imaginarias. Lee “Guía para la Biblia” de Isaac Asimov que tú mismo me recomendaste. No creo que me hayas dado a leer “esoterismo”. A menos que te estés contradiciendo. (Todo lo que he afirmado se encuentra allí)
    Si quieres negar la evidencia ¿cómo puedes alcanzar la verdad?
    El amor:
    cursi.
    (Etim. disc.).
    1. adj. Se dice de un artista o de un escritor, o de sus obras, cuando en vano pretenden mostrar refinamiento expresivo o sentimientos elevados.
    2. adj. coloq. Dicho de una persona: Que presume de fina y elegante sin serlo. U. t. c. s.
    3. adj. coloq. Dicho de una cosa: Que, con apariencia de elegancia o riqueza, es ridícula y de mal gusto.
    Lo que yo afirmo no es nada cursi, al menos que tengas otro significado para esta palabra.
    El amor al enemigo, que aparece en el nuevo testamento se refiere al “ágape”.
    La mejor manera de acabar con tus enemigos es convirtiendolos en tus amigos.
    Tratar bien al enemigo, es una forma de demostrarle que tú no tienes nada en contra de él, así, éste se morirá de vergüenza al ver que te trata injustamente (esto lo he vivido)y acabará accediendo a tu amistad.
    Estoy de acuerdo contigo en que el amor se debe sentir y practicar, y no pregonar.
    Aunque yo no he dicho que sea un santo, ni que amo a todo el mundo. El amor es un ejercicio diario, como dice el proverbio chino que ya cité.
    También en que debería buscar la forma de hallar una sociedad igualitaria y justa, para no depender de la caridad ajena, pero ¿qué ha hecho el ser humano para conseguirlo? ¿Qué haces tú para conseguirlo?
    “La vida es muy peligrosa. No por las personas que hacen el mal, sino por las que se sientan a ver lo que pasa.”
    Albert Einstein
    Tú mismo estás pregonando algo que no haces.
    Un saludo

  90. Walter says:

    David:
    Tambien he leído la Guia para la Biblia (Antiguo y Nuevo Testamento) de Isaac Asimov y no encontre en ninguna parte que susutente tus afirmaciones esotéricas y mitologicas.
    Walter

  91. Walter says:

    Hola de nuevo David:
    Me tome un tiempito para buscar algo del Buen Doctor con referencia a tus afirmaciones, y aqui va:
    ¿Y su investigación de la Biblia le indica que en muchos puntos contradice a la ciencia moderna?
    Sí. Aunque eso no significa automáticamente que la ciencia es verdadera y la Biblia falsa, si bien yo sí lo pienso. La gente debería examinarla. Lo que desde luego no se puede hacer, es decir que la Biblia es correcta sin haberla examinado.
    ¿Isaac, cómo describiría su propia posición? ¿Agnóstica, atea, racionalista, humanista?
    Soy un ateo por los cuatro costados. Me costó mucho tiempo decirlo. He sido ateo desde hace años, pero de alguna manera sentía que era intelectualmente irrespetuoso decir que uno era ateo, porque suponía un conocimiento que no poseía. Era más correcto decir que se era humanista o agnóstico. Finalmente he decidido que soy un ser tanto emocional como racional. Emocionalmente soy un ateo. No tengo las pruebas para demostar que dios no existe, pero sospecho con tanta intensidad que no existe, que no quiero perder el tiempo en ello.
    Pero la carga de la prueba está en la persona que sostiene que dios existe. Uno no cree en los Reyes Magos, pero no puedes negar su existencia. La obligación de demostar su existencia es de aquellos que la defienden.
    Sí. De todos modos, soy ateo.
    Ha explicado bien su postura. ¿Pero puede la gente vivir sin el mito de dios, sin religión? Usted no la necesita, se supone. ¿Pero el ser humano en general la necesita?
    Bueno, ciertos seres humanos puede que sí. Da cierto confort, supongo, pensar que estarás con todos tus seres queridos después de la muerte, que la muerte no es el fin, que vivirás de nuevo en una tierra de nunca jamás en medio de la felicidad. También puede ser que cierta gente reciba un gran placer de la idea de que todos los que no les gustan irán directos al infierno. Todo esto son consuelos. Pero a mí no me consuelan. No me interesa que alguien sufra enternamente en el infierno, porque no creo que ningún crimen es tan infinito como para merecer un castigo infinito. No creo que yo podría condenar a nadie eternamente. Soy contrario al castigo.
    Sería una maldad maximizada, ¿no?
    Sí. Yo no podría hacerlo, y si presuponemos que ese dios es mucho más noble que yo, tampoco podría. Además, no puedo dejar de pensar que la ‘bienaventuranza’ eterna sería algo muy aburrido. No comprendo ninguna cosa que sea eterna. Pienso que después de la muerte no hay nada. Y la nada es lo único que yo pienso que sería aceptable.
    ¿Cree que uno puede vivir de forma moral y con sentido, siendo justo y noble, sin creer en un dios?
    Bueno, igual sin que con una creencia en un dios. No pienso que la gente que crea sea automáticamente noble, ni tampoco que sean automáticamente malos. Tampoco pienso que los que no creen sean automáticamente una u otra cosa. Pienso que cada ser humano elige, y francamente pienso que acaso, si no crees en un dios, esto te da mayor responsabilidad, en el sentido de que debes vivir con tus propios sentimientos éticos. Pero si crees en ese dios, también crees en el perdón. Yo no tengo a nadie que me perdone.” Extractos de una entrevista a Isaac Asimov
    Saludos
    Walter

  92. david says:

    Walter:
    Mi afirmación acerca de la fecha de las epístolas se narra en el capítulo de Romanos.
    La fecha del Apocalipsis se encuentra en el capítulo del mismo nombre.

  93. david says:

    También tengo en archivo esa misma entrevista a Isaac Asimov (entre otras).
    Tampoco digo que el relato del Génesis no contradiga a la ciencia.
    Extraido de la misma entrevista:
    ¿Considera la Biblia como un documento fundamentalmente humano o piensa que es obra de una inspiración divina?
    La Biblia ES un documento humano. Contiene partes de poesía y gran parte consiste en relatos históricos que son de los más antiguos que han llegado hasta nosotros. Samuel 1 y 2 se adelantan en varios siglos a Herodoto. Asimismo contiene enseñanzas morales que han tenido éxito, pero el resto es en el mejor de los casos alegórico y en el peor de los casos mítico y legendario. Francamente, no veo nada divinamente inspirado en todo ello. Pienso que todo aquello que los seres humanos tienen de inteligente es de origen humano, sin excepciones.
    ¿Qué puede decir sobre las interpretaciones metafóricas? Cuando yo era joven, la tendencia era que debíamos aceptar el creacionismo y que no era incompatible con la evolución, sino que se interpretaba metafórica o alegóricamente como en términos de estadios.
    Siempre existirá esa tentación. Estoy bien dispuesto, por ejemplo, a interpretar la Biblia de forma alegórica y de hablar de los días de la creación como eones de duración infinita. Hay quien dice que los ‘días’ podrían tener una duración muy grande, aunque incluso eso horroriza a algunos creacionistas. Podría decirse que todo el capítulo primero del Génesis es un poema magnificente que representa la creación como algo que trasciende a todos esos estúpidos dioses humanoides de Babilonia, presentando a una deidad abstracta que con su sola palabra da existencia al universo. Podrías compararlo con el Gran Estallido (Big Bang). Podrías decir que cuando dios dijo ‘Hágase la luz’ tuvo lugar el Gran Estallido, y podrías seguir así con todo tipo de paralelismos y similitudes, las que quieras. No tengo nada en contra de eso.
    ¿Pero no son equivocaciones esos estadios, incluso metafóricamente?
    Dijo antes que, según la Biblia, dios creó la tierra antes que los cuerpos celestes.
    Sí. Algunos estadios están equivocados. Pero podrías decir que cuando la Biblia dice ‘en el principio dios creó los cielos y la tierra’ se refiere en realidad al universo. Podríamos decir que, cuando se escribió el primer capítulo del Génesis, cuando la gente hablaba de la tierra se refería al todo; y ahora que nuestra visión y perspectiva han cambiado, hemos visto que se referían al universo. Así, pues, podemos cambiar el sentido de las palabras si es necesario. Pero los creacionistas no lo harán; insisten en la interpretación literal del relato de la creación. Cuando dice ‘tierra’ quieren que signifique ‘tierra'; cuando habla de ‘un día’, quieren que signifique un día de 24 horas.
    Sobran comentarios

  94. Walter says:

    Bueno, estoy de acuerdo con eso. Más aún, metaforica y alegoricamente tambien son validos los mitos creacionales de los mayas, aztecas, incas, babilonios, egipcios, dogones, hindúes, chinos, japoneses, normandos, etc., pero no hay una explicación mejor que la otra, todas son igual de validas que la mitología judia, todas son proceden de la imaginación de la gente; todas pertenecen al campo del ESOTERISMO. ¿O crees que la imaginación judía tiene más valor que la imaginación griega, o romana, o cualquier otra?
    Menos tiene que ver la interpretacion de alegoría y metáforas con la demostración de la historicidad de Jesus o de la Biblia, que era el tema en debatre antes de que lo rehuyas y te vayas por las ramas.
    Walter

  95. Walter says:

    Hola David:
    Aunque pense dejarlo alli, para no provocar la ira junjaniana, justificada pues nos repetimos otra vez; como siempre leo con mucho interes tus opiniones, no puedo resistir la tentacion de responderlas, y aqui va:
    * Los pueblos primitivos: No puedes generalizar, tienes que diferenciar a los primitivos judíos de epocas biblicas de los muchismimo mas avanzados babilonios, egipcios, griegos, persas, romanos, hindúes, chinos, etc. El desarrollo de los pueblos no se mide por sus mitos. Por ejemplo, mientras los judíos escribian sus explicaciones esotericas del mundo, el griego Eratostenes ya habia medido la circunferencia de la tierra.
    * Tambien es falso el concepto de que el mito monoteísta es mas avanzado, primero, porque no existe realmente hay santçisimas trinidades, hay un dios demonio, diosas virgenes, hay legion de dioses angeles, hay semidioses profetas, etc. y segundo porque el monoteismo es por definicion, por accion y por historia absolutamente intolerante frente a otras creencias. Es mucho más avanzado creer que cada pueblo tiene su dios y respetarlo.
    * El concepto deísta “ilustrado” de la actualidad (Einstein no creia en dioses personales) tambien esta acorralado en el último resquicio que le permite el razonamiento; en el mismísmo origen del Universo. Y aún allí se tambalean, pues, en mecanica cuantica se demuestra que “dios si juega a los dados” y como si fuera poco, el destacado cientifico Stephen Hawkings dice que, es posible que el Universo ni siquiera tenga un origen
    * Por enesima vez usas los siguientes terminos: “Algunas de ella pudieron”, “Tal vez”, “Se supone”, “Ya fuese huyendo o llevado”, “ya es mencionado”, y antes usastes hasta el cansancio “se dice”, “algunos opinan”, “la mayoria dice”, “debe ser”, etc, etc. Sustenta tus suposiciones y afirmaciones; ya te mencione antes cual es mi idea de documentar y citar fuentes.
    * No es etico sacar de contexto ni dar otro sentido a las frases que citas. Por ejemplo, Asimov dice que Samuel se adelanta varios siglos a Herodoto. Pero eso no prueba que Samuel es un libro de Historia. Asimov se refiere a que los escritos atribuidos a un tal Samuel son mas antiguos que los del escritor griego, pero no esta afirmando que sea cierto Samuel 2:8 que habla de “los pilares sobre los que Dios asienta la Tierra”, eso es esoterismo y mitologia.
    * Aqui va otra frase irracional que debes repensar: “El mito (fantasía) es una forma figurada (fantasia) de acceso al Logos (fantasia)”
    * Dices que Logos es: “una explicación accesible” y “simple” ¿cuál explicación? A continuacion dices que “NO SON SOBREHUMANAS”, pero no dices que son.
    Te debo algunas, para despues;
    Saludos
    Walter

  96. Walter says:

    David:
    Aqui van las que te debía:
    Pensé que te retractarías del absurdo “Conocer lo inconocible” pero como insistes, me das la oportunidad de explayarme: Lo “inconocible” es lo que NO se puede conocer, por lo tanto ni con mitos ni con nada podríamos conocerlo, sino no sería “inconocible”, sería “desconocido”. Por ejemplo para mí el origen del Universo (o Universos) es inconocible. Y cualquier intento de conocer lo inconocible esta viciado desde el inicio con el absurdo, la ciencia no se ocupa de lo “inconocible”, sino de lo desconocido.
    Los mitos no hacen que CONOZCAMOS ni lo “inconocible”, ni lo desconocido (que seria el término correcto), LOS MITOS SON UNA EXPLICACIÓN INVENTADA donde se cubre la falta de información con elucubraciones imaginarias, son cuentos.
    Es cierto que de la mitología se puede extraer conocimientos de la historia, costumbres, creencias, etc. de un pueblo, pero eso ocurre con todas las mitologías no solo con la bíblica. No podemos decir que unas mitologías sean mejores que otras:
    Por ejemplo el mito del Dios Sol, a mí me parece excelente adorar al Sol, la vida en nuestro planeta solo existe gracias al Sol, y el Sol es impersonal y brilla igual para todos. En cambio, me parece salvaje e irracional, adorar al Dios de la Biblia que ¡exterminó toda la vida en el planeta! (¿Y ese es el dios que defines como “Dios es Amor”?)
    Qué es el “Logos”? Según RAE, es el “principio racional del Universo” y en teología cristiana se aplica a “el Verbo”, “el Hijo de Dios”; en Wikipedia, dice: Logos: “razonamiento”, “argumentación” o “habla”. También puede ser entendido como “inteligencia”, “pensamiento”, “ciencia”, “estudio”, sentido”. Es decir, el que menciones Logos, no dice nada en particular. ¿A qué te refieres? ¿Logos=Dios? ¿Con base en qué?
    ¿El motor que dices que arranco todo quien lo encendió? Es valida esta pregunta si partes de la premisa de que “todo tuvo una causa”. Salvo que te escondas en las monsergas medioevales tomasinas de los entes “contingentes” y los entes “necesarios”, pues en ese caso te adelanto que tal idea se refuto fácilmente hace siglos pues nada prueba que esa división entre entes contingentes y necesarios exista. Además la definición de ente necesario es “ente creador”, es decir Dios. El absurdo es:
    El ente necesario (creador que es Dios) prueba que Dios (que es el creador necesario) existe.
    Lo judíos no mataban a los que decían que el Sol no era un Dios, mataban a todos los demás. Mataban a los que decían que el Sol era Dios, que la Luna era Dios, que Júpiter era Dios, que la Tormenta era Dios, que Baal era Dios, que no había Dios, etc. es decir ASESINARON a pueblos enteros con la excusa del “falso dios ajeno”. Exterminaron a miles de no judíos para arrebatarles sus tierras, pero “no es que fueran saqueadores genocidas, no; solo seguían órdenes de Dios”. ¡De ese Dios que es Amor!
    Cursi: No no tengo otro siginificado para la palabra, a mi si me parece cursi decir Dios es Amor; porque”en vano pretende mostrar sentimientos elevados, pero que en realidad es ridícula y de mal gusto.”
    Eso de “amar al enemigo” es otra contradicción. El enemigo es alguien a quien odias y que te odia, si se amaran no serían enemigos. Y no digas “tratar” bien, porque eso es otra cosa.
    En cuanto a la sociedad igualitaria, no es relevante lo que yo haga o no haga, pero para el caso sería igual de cursi que tu frase “Dios es Amor” si yo enviara mensajes diciendo “Dios es Justicia” (o ¿”el Ateismo es Justicia”?).
    En lugar de redactar tus mensajes tipo “telegrama de una línea” con variadas afirmaciones rebatibles; debías tomar una sola de ellas y fundamentarla apropiadamente; de lo contrario pones tantos puntos en la agenda que se pasa de un tema a otro sin llegar a ningún lado. Agotemos un tema antes de pasar a otro.
    Finalmente, podrías especificar que es eso que “pregono pero no hago”? Igualmente por allí lanzaste la frase “Si quieres negar la evidencia, ¿Cómo puedes alcanzar la verdad? Y me intriga, ¿es una frase célebre de alguien y te olvidaste poner el autor? O ¿estas insinuando que yo niego las evidencias que me presentas? Si es esto último lo lamento, no fue mi intención, podrías explicarme nuevamente ¿A qué evidencias te refieres?
    Un gran saludo
    Walter

  97. david says:

    Hola Walter:
    Frente a la afirmación de tu fuente: “El documento literario cristiano más antiguo es el Apocalipsis de Juan, del 68-59 d.c. hecho por un Juan de la isla de Patmos, uno de los profetas de la venida del Mesías.”
    Lo que dice “Guía para la Biblia” de Isaac Asimov:
    “Las diversas epístolas componen los primeros escritos del Nuevo Testamento. Algunas de ellas pudieron redactarse en fecha tan temprana como el 50 dC, casi veinte años antes de que el primero de los evangelios que ahora poseemos alcanzara su forma actual, y tal vez cincuenta años antes de que se escribiera el cuarto.”
    “Se supone, pues, que Juan salió de Éfeso y marchó a Patmos, ya fuese huyendo de la persecución o llevado al cautiverio en los últimos años de Domiciano, y que volvió a Éfeso tras la muerte de ese emperador, cuando el acceso al trono del benigno Nerva puso fin al momento crítico anticristiano. Como Domiciano fue asesinado en el 96, el Apocalipsis debió de escribirse en el 95.”
    Frente a tu afirmación:
    “Si quieres saber porque y como triunfó el mítico mesianismo de Jesús; como absorbió a las otras leyendas mesiánicas y a los otros Mesías; y sobre la formación paulatina de su dogma en base a la fusión de creencias helénicas y orientales con las judías; pues lee la historia del Imperio romano.”
    Las epístolas de Pablo de Tarso, escritas antes de que el imperio romano adoptara el cristianismo.
    En ellas ya se habla del culto a Jesús, de su resurrección, de su redención, etc.
    Pablo se define a él mismo como judío fariseo, secta que era escrupulosa con las demás religiones.
    Tu afirmación:”Bueno, estoy de acuerdo con eso. Más aún, metaforica y alegoricamente tambien son validos los mitos creacionales de los mayas, aztecas, incas, babilonios, egipcios, dogones, hindúes, chinos, japoneses, normandos, etc., pero no hay una explicación mejor que la otra, todas son igual de validas que la mitología judia, todas son proceden de la imaginación de la gente; todas pertenecen al campo del ESOTERISMO. ¿O crees que la imaginación judía tiene más valor que la imaginación griega, o romana, o cualquier otra?”
    Tras haberte finalmente convencido, digo que cada mito se adapta más a la verdad. Para mí, al no confundir los elementos con dioses, me parece superior la mitología judía.
    Tu afirmación:”Stephen Hawkings dice que, es posible que el Universo ni siquiera tenga un origen”
    También hay un mito que dice:”Algunos necios declaran que un Creador hizo el mundo. La doctrina de que el mundo fue creado es equivocada y hay que rechazarla.
    Si Dios creó el mundo, ¿dónde estaba Él antes de la creación?…

  98. Walter says:

    David:
    Tu ultimo comentario me hace pensar que no lees mis respuestas o que no las entiendes. Te agradeceria que las vuelvas a leer.
    Lamentablemente, solo me has demostrado que prefieres el esoterismo al estudio serio de la historia y la ciencia.
    Saludos
    Walter

  99. Walter says:

    David:
    Te propongo lo siguiente:
    Centrémonos primero en las cartas paulinas: Explícame, por favor, como es que prueban que Jesús existió.
    Después podemos tocar uno por uno los demás temas que has planteado.
    Saludos,
    Walter

  100. david says:

    Walter:
    Yo no he dicho que las epístolas paulinas prueban la existencia de Jesús. Sólo he dicho que es una prueba que nos indica que el culto a un mesías llamado Jesús, existía mucho antes de que los romanos adoptaran el cristianismo como la religión de su imperio, además de la doctrina de la resurrección y de la redención de Cristo.
    Luego lo que afirmas es una falacia.
    En cuanto a que prefiero el esoterismo al estudio serio de la Historia y de la Ciencia, ¿te importaría indicarme de dónde lo deduces?
    Un saludo

  101. david says:

    Hola de nuevo Walter:
    Insististe para que volviera a leer tu comentario y eso mismo hice. Sin “andarme por las ramas” vuelvo a rebatir:
    Consulté la cita del libro de Samuel 2:8 que habla de “los pilares sobre los que Dios asienta la Tierra”.
    Esta afirmación se encuentra en el capítulo que cita la oración de Ana, madre de Samuel.
    Asimov dice:
    “No critico a los antiguos por no saber lo que nosotros sabemos. Costó siglos llegar a estos conocimientos, y los antiguos contribuyeron en su medida. Eran tan inteligentes como nosotros y tan buscadores de la verdad. Pero, de hecho, no tenían tantos conocimientos como nosotros tenemos ahora. ”
    Lo que estás afirmando es una falacia.
    _________
    Y digo yo, si los griegos eran tan avanzados de pensamiento, no sé por qué asesinarían a los que afirmaron que el sol no era un dios. Los griegos no eran más ni menos tolerantes que los judíos.
    Eratóstenes: no dudo acerca de su capacidad científica, pero lo cierto es que en la sociedad donde vivía, pocos le creyeron, anteponiendose los estudios de Ptolomeo, hasta que llega Copérnico, Galileo, etc.
    _______
    Monoteísmo: ¿Cuando he dicho yo que el monoteismo es más avanzado? Respeto cualquier creencia sea en el dios que sea, siempre que tenga algún fundamento.
    Para mí, adorar a una estatua de mármol, escayola o mader, para mí es algo sin sentido.
    Puede ser que te refieras a que considero más avanzada la idea judía de que creyeran en un sólo dios, del cual surgiría todo, sin confundirlo con los astros y mucho menos con una deidad humanoide.
    Si es eso, puedes dar por supuesto que la mente judía era más avanzada y más madura.
    También he de decir, que cada persona tiene un concepto de monoteísmo distinto al que puede tener un católico o un musulmán.
    Los saduceos, por ejemplo, no creían en ángeles, ni semidioses, ni nada parecido a lo que tú mencionas, luego lo que afirmas es una falacia.
    ____
    Pensamiento ilustrado de Dios:
    Estoy de acuerdo con que se trata de un dios no personal, sino que se concibe como el motor que todo lo genera. Mencioné a Einstein y a Spinoza, porque el dios del Génesis se podría interpretar de esa manera.
    Tus afirmaciones:
    “Lo “inconocible” es lo que NO se puede conocer, por lo tanto ni con mitos ni con nada podríamos conocerlo, sino no sería “inconocible”, sería “desconocido”. ”
    Eso es exactamente a lo que se refiere Platón. Si lees su filosofía, verás que él hace referencia a mitos para explicar sus ideas. Te recomiendo “el banquete” y “la república”.
    “Es valida esta pregunta si partes de la premisa de que “todo tuvo una causa”. ”
    Es a lo que me refería, ya lo hablamos en otro blog.
    Un saludo

  102. david says:

    Walter:
    La idea radical que tú mencionas de la Biblia, choca con el reverso del pasaje de Jonás, de carácter universalista.
    “Yahvé le dijo: Tú tienes lástima del ricino, en el cual no trabajaste para hacerlo crecer…
    ¿Y no voy a tener yo piedad de Nínivé, la gran ciudad, donde hay más de 120.000 hombres que no distinguen su mano derecha de la izquierda, y además, numerosos animales?”
    (Jonás, 4: 10-11)
    Jonás aprende así una lección de clemencia y piedad y el autor recalca el amor de Dios hacia todas sus criaturas, rechazando las miras estrechas de los nacionalistas.

  103. Walter says:

    Hola David:
    OK, prueba 1, desestimada. Aceptas que las cartas paulinas no prueban que Jesucristo sea un personaje histórico. Pasemos a otro tema:
    Prueba 2:
    * El mito cristiano precede a la oficialización de la religion por el imperio romano.
    Mi opinión:
    La propia declaración es ridiculamente obvia pues, si no hubiera existido previamente el Cristianismo, ¡¿Cómo podía ser oficializado por los romanos?!
    Que la oficialización romana sea posterior a la existencia del mito mesiánico de Jesus no significa que las diversas creencias populares mayoritarias del imperio romano NO existieran desde antes que el mesianismo de Jesús, ni que tuvieran que esperar a que oficialicen al cristianismo para fusionarse o influir en él.
    Ahora la palabra está en tu terreno.
    * ¿Como prueba eso que Jesus es un personaje histórico?
    Atentamente,
    Walter
    Nota: Tu inclinacion al esoterismo ¿la podríamos ver cuando agotemos este tema?, para no estar saltando de un lado a otro, si te parece. Gracias.
    Nota2: El término “Fuente” tiene varios significados que no hay que confundir: A.- Principio, fundamento u origen de algo. B.-Material que sirve de información a un investigador o de inspiración a un autor. C.-Fuente de información. Confidencias, declaraciones o documentos que sirven de base para la elaboración de una noticia o reportaje periodístico. D.-Personas que emiten esas declaraciones. Por ejemplo, Asimov y Guevara son “fuentes de informacion” para nosotros pues de ellos obtenemos información; pero ellos a su vez tienen “sus fuentes”. Para seguir con el ejemplo, Guevara afirma que el apocaliptico Juan es el más antiguo en base la siguiente fuente: El papiro P52 que data del 125-130 dc. con un breve extracto (copia en griego) de Juan, y que es el escrito MAS ANTIGUO que existe del cristianismo.

  104. Walter says:

    Te pido unos favorcitos, David,
    ¿Podrias dejar de repetir mis argumentaciones (ya están escritas en el foro y las sacas de contexto al copiarlas) Debías más bien concentrarte en fundamentar con más amplitud tus propios argumentos. (No necesitas llenar el espacio con frases célebres)
    Asimismo, me gustaría que la próxima vez que digas que “me has demostrado algo”, tengas la gentileza de explicarme que es lo que me has demostrado y cómo. Para enterarme.
    Por último, afirmas que yo no practico la igualdad social que pregono ¿cuándo la he pregonado? ¿Y que sabes tu de mi vida? Cuando mencione la justicia fue para explicarte porqué tu frase “Dios es Amor” es cursi y te dije que SI YO DIJERA lo de la justicia, TAMBIEN SERIA CURSI. Era un ejemplo de cursilería, no es que yo lo pregone, no te confundas, por favor.
    Y te agradecería que mantengamos estos asuntos secundarios y de forma, separados del tema de la historicidad de Jesus, que es lo realmente interesa.
    Gracias
    Walter

  105. david says:

    Hola Walter:
    Partiendo de que el “mito” de Jesús es anterior a que el imperio romano adoptase la doctrina cristiana:
    Jesús es un personaje que aparece en la sociedad judía. Los judíos, tenían cuidado de no mezclar su doctrina con otras, al menos que se pudieran fundamentar en las Escrituras.
    Los cristianos, que ya creían en un mesías llamado Jesús, afirman que éste era judío, y que fue crucificado por Poncio Pilatos. Luego el Cristo que menciona Tácito, es, sin duda alguna, Jesús.
    Pablo, persigue a cristianos como él mismo relata en Gálatas, y afirma que era fariseo y se jactaba de seguir a rajatabla la ley de Moisés.
    Pablo no crea el mito de Jesús, sino que oye hablar de él por medio de sus seguidores, que afirmaban que lo habían visto y compartido camino con ellos.
    Antes de que el imperio romano adoptara a Jesús como dios, el cristianismo sufrió divisiones, tales como la doctrina gnóstica y el arrianismo.
    Si lees la biografía de Constantino, verás que al final, el emperador se convierte al arrianismo.
    Luego el cristianismo del imperio romano no es el mismo que practicaban los cristianos primitivos.
    PD1:Lo que te he demostrado es que el culto a un mesías llamado Jesús existía antes de la conversión del imperio romano, para ello te cité “Guía para la Biblia” de Asimov, la misma fuente para indicarte que el Apocalipsis no es el documento cristiano más antiguo que se conoce.
    PD2: Nada más lejos de mi intención es ofenderte o conseguir que te sientas incómodo. Te pido perdón si en algún momento te he ofendido o sacado de contexto.
    Un saludo

  106. david says:

    Nota: Tómese en cuenta que Tácito no habla de una creencia de los cristianos, sino que afirma claramente: “Su nombre deriva de Cristo, el cual durante el Imperio de Tiberio había sido ajusticiado por orden de Poncio Pilato, procurador de Judea”
    Un saludo

  107. david says:

    Nota de “Guía para la Biblia” de Isaac Asimov:
    “Y por fin aparece Jesús adulto ante Juan el Bautista para bautizarse.
    Resulta que Josefo, que menciona a Juan el Bautista, no alude a Jesús. Claro que en su historia de los judíos hay un párrafo dedicado a Jesús; pero tal pasaje interrumpe la continuidad del discurso y se asemeja de manera sospechosa a un añadido posterior.
    Los eruditos suelen creer que se trata de una inserción realizada por algún copista cristiano primitivo que, escandalizado porque Josefo hablara de la época sin mencionar al Mesías, pensó que el añadido era un acto piadoso.
    Tampoco hay efectivamente mención alguna de Jesús en ningún documento de la época, aparte del Nuevo Testamento.
    Debido a esto, ha habido quienes han negado la existencia de Jesús, pero eso es ir demasiado lejos. Los evangelios sinópticos no llevan la marca inequívoca de la obra de ficción, como los libros de Tobías, de Judit y de Ester, por ejemplo. No están repletos de anacronismos, sino que muestran precisión al hablar del ambiente de la época. Por ejemplo, lo que dicen de Juan el Bautista concuerda con lo que afirma Josefo. Además, no contienen incidentes que estén en franca contradicción con hechos históricos conocidos.”

  108. Walter says:

    David:
    Sobre el asunto de si “la precedencia del mito de Jesús a la oficialización de la religión prueba que Jesús es histórico”
    Afirmas que el mito de Jesús apareció en la sociedad judía y que los judíos no mezclaban su doctrina. Eso no es exacto, los judíos no aceptaban Mesias “Hijos de Dios” eso era una costumbre griega y una blasfemia para los judíos, para quienes sus Mesias eran líderes terrenales. También sabes de la influencia que tuvieron otras creencias en el judaísmo, por ejemplo las tradiciones babilónicas, con Diluvios, Satanes y otras lindezas; o la influencia del pensamiento helénico con el Verbo, el Logos y demás platonismos. Entonces, los judíos podían tener todo el cuidado que quisieran, pero sus tradiciones SON una mezcla de las tradiciones de diferentes pueblos.
    Entonces, volvemos al punto, ¿Por qué no iba a ser lo mismo con el cristianismo? Y de hecho que lo fue y en mucho mayor medida, tanto así que el cristianismo termina separándose del judaísmo e imponiéndose entre los gentiles, que ven en él cumplirse sus propias expectativas espirituales y ven a los judíos como enemigos y asesinos de Jesus.
    No hay ninguna necesidad que el cristianismo sea oficializado para que empiece a fusionarse con las demás religiones del imperio, por el contrario la oficialización es la conclusión del sincretismo del último par de siglos, un proceso de donde surgió el Mito de Jesús como eje unificador con su historia se va escribiendo con más detalle conforme transcurren los años evoluciona el dogma.
    Repito y resumo:
    La mezcla de religiones de los pueblos no judíos con el judaismo mesiánico es determinante en la formación del Mito de Jesus y del cristianismo como una nueva fe en un Dios para todos y no solo para los exclusivistas-sectarios-e-intolerantes hebreos, con su Unico-Dios-Verdadero-y-exclusivo de su raza y del cual son el único pueblo escogido”;
    El proceso de sincretismo religioso que dio origen al cristianismo, se inicio unos 100 años antes de la supuesta existencia de Jesús y no en épocas de Constantino, siendo esta época por el contrario la de culminación y no de inicio de la formación del credo cristiano. (También hubo influencias posteriores a Constantino, pero ese es otro tema, baste decir que hasta ahora siguen las influencias que afectan el dogma)
    Por lo expuesto, considero que tu argumento es insuficiente y no prueba que Jesucristo haya existido. Te devuelvo la palabra.
    Walter

  109. Walter says:

    El documento cristiano más antiguo en existencia es el “Papiro Rylands” (P52 Juan)
    No existe ningun original de ningun documento cristiano de los primeros siglos.

  110. david says:

    Hola Walter:
    Estoy de acuerdo con tus afirmaciones acerca de la influencia babilónica en la doctrina judía.
    Pero lo cierto es que Jesús no tiene ninguna influencia babilónica ni griega.
    Si, como dices, la idea de un Hijo de Dios era blasfema para el judaismo, éste mesías no hubiera surgido en Judea, como cita Tácito, y muchos judíos no se hubieran convertido a él, como por ejemplo Pablo de Tarso.
    Jesús hubiera sido un loco afirmando que era dios en una sociedad radicalmente monoteísta, hubiera tenido más éxito en Grecia, Egipto, India, etc.
    También estoy de acuerdo en que los cristianos
    se separaron de los judíos, pero los cristianos primitivos, al menos lo que narra los evangelios, eran judíos. Estos luego predicarían a Jesús entre los gentiles.
    En cuanto al papiro Rylands, podrías darme una fuente que me indique tu afirmación.
    Un saludo

  111. Walter says:

    David:
    Tu argumento de que si Jesus no hubiera existido en Judea no lo citaria Tacito, no es válida y es retroceder el debate. Ya antes aceptaste que Tacito no prueba que Jesús sea histórico, así que no volvamos a lo mismo.
    Igual ocurre con tu mención a Pablo pues ya aceptaste que sus “cartas paulinas” no prueban que Jesus existiera históricamente. Asi que evitemos dar tantas vueltas al tema.
    En cuanto a tus deducciones:
    Decir que si Jesus no hubiera surgido exclusivamente del judaísmo muchos judíos no se hubieran convertido, es una contradicción evidente: Si Jesus surgía del judaísmo ¿Porque tenían que convertirse los judíos?
    Antes dijiste que el judaismo tenia cuidado de no mezclar su doctrina con otras, ¿ahora reconoces que si se mezclaba? Solo mencionas la influencia babilónica. ¿Niegas que tenga influencia griega? ¿Como explicas entonces el Logos en la Biblia si tu mismo mencionaste que era idea de Platon?
    Al contrario de lo que tu especulas, la historia demuestra que los judíos NO ACEPTABAN la idea de OTRO DIOS pues mas alla del esoterismo cristiano, la idea de TRES DIOSES ES POLITEISMO, es una creencia obviamente NO judía, y es más bien una ABOMINACION para los judíos.
    Y tu lo reconoces al decir que Jesus hubiera sido loco para afirmar en Judea que el era Dios, y que hubiera tenido exito en Grecia, Egipto, etc. ¡pero si eso es es lo que ocurrió!
    ¿No te das cuenta que con esa afirmación estas reconociendo que Jesus no es, un invento exclusivamente judío sino por el contrario una mezcla de creencias?
    El mito de Jesus toma el mesianismo (terrenal) del los judíos y lo mezcla con los mitos griegos y orientales, que incluían dioses hombre, y esotericas multidivinidades. Eso es lo que se encuentra en los evangelios, una combinación de mitologías y simbolismos de diferentes religiones de la época, escritas además bajo el prestigio indudable que tenía el antiguo libro judío llamado La Biblia.
    Y claro, algunos judíos se convirtieron, especialmente, cuando se volvio peligroso ser judío, despues del fracasado levantamiento del año 70 en que los romanos destruyeron el templo judío de Jerusalem y expulsaron a los israelitas de Palestina.
    Por último, también has aceptado antes que los evangelios NO son libros de historia, así que tus referencias a ellos como pruebas carecen de valor.
    Devuelvo la pelota a tu campo.
    Saludos
    Walter
    Nota: Papiro Rylands (Wikipedia)
    El papiro Rylands (P52) es el más antiguo de los manuscritos que se han encontrado de los cuatro evangelios canónicos. Se descubrió en el desierto de Egipto. Se publicó en 1935. Contiene algunos versículos del capítulo 18 del evangelio de Juan (Jn 18,31-33.37-38). Según el estudio grafológico es anterior al año 150 (suele datarse hacia 125-130).

  112. Walter says:

    David:
    Estaba releyendo tus interesantes comentarios y me fije que en varias oportunidades has calificado mis argumentos como “FALACIAS”
    El significado del término, es el siguiente: RAE/ falacia. 1.Engaño, fraude o mentira con que se intenta dañar a alguien. 2. Hábito de emplear falsedades en daño ajeno.
    Por tanto:
    RECHAZO POR CALUMNIOSA LA ACUSASION QUE ME LANZAS. No tengo intención de dañar a nadie ni tengo el hábito de emplear falsedades en daño ajeno.
    Walter

  113. david says:

    Hola Walter:
    Cierto que Jesús hubiera sido un loco afirmando que era dios, pero el Jesús bíblico no corresponde con ese perfil.
    En cuanto a las falacias, mi libro de filosofía de bachillerato las denomina como “argumentos que parecen válidos, pero no lo son por la forma en que están expuestos, o por que no muestra los argumentos que están en contra de su afirmación”.
    Sólo expresaba ese significado, te pido perdón si has entendido por esa palabra otra definición. Sé que no intentas dañar a nadie.
    Un saludo

  114. david says:

    Hola de nuevo:
    Walter, no he negado que la religión judía (como puede serlo cualquier otra religión) tenga influencia de otras culturas, dije: “Los judíos, tenían cuidado de no mezclar su doctrina con otras, al menos que se pudieran fundamentar en las Escrituras.”
    Vuelvo a pedirte perdón, por los malos entendidos.
    Un saludo

  115. Walter says:

    David:
    No olvidemos el tema en debate: Tu afirmaste que la precedencia del mito de Jesús a la oficialización de la religión prueba que Jesús es histórico.
    Te he enviado abundantes argumentos en contra de tu hipotesis pero tu no los respondes, ni mucho menos los refutas. Has aceptado algunas de mis argumentaciones pero otras simplemente las has ignorado. Ahora publicas una escueta e insustentada declaración del “perfil” del Jesús bíblico, que no entiendo que significa ni que tiene que ver con el tema en discusión.
    ¿Insistes en que las otras religiones del imperio recién influyeron en el cristianismo después de su oficializacion en el sigo IV?; o ¿reconoces que hubo influencia desde su origen?
    Walter

  116. Walter says:

    Nota para David:
    Sobre tu definición de Falacia, creo que antes de usar el término debías demostrar que mis argumentos están errados, no basta que lo digas.
    Walter

  117. david says:

    Hola Walter:
    Sigo firme en mi afirmación.
    Creo que la religión cristiana parte de un personaje que fue mitificado, al igual que el budismo mitificó a Siddartha.
    Luego se añadiría los dogmas y otros mitos de otras culturas.
    Dime que he ignorado y te diré lo que pienso.
    Te decía que el argumento acerca de que el papiro Rylands, no demuestra que el Apocalipsis sea el primer documento cristiano, sino que lo son las epístolas de Pablo. Para ello cité “Guía de la Biblia” de Asimov. Puede ser que no tuvistes en cuenta el libro de este autor, pero ello no hace un argumento más válido que otro.
    Un saludo

  118. david says:

    En cuanto al perfil del Jesús bíblico o evangélico, quise decir que no corresponde con el de un demente.

  119. Lic Eduardo Cruz says:

    Hola David y Walter espero que se encuentren bien
    esperando que este foro no se convierta en un circulo vicioso de comentarios que no nos lleven a ningún lado y donde se trate de demostrar
    quien sabe mas del tema
    para ganar una discusión intentando desacreditar a otros ridiculizándoles con sarcasmo pero perdiendo el objetivo principal del foro.
    por mi parte yo estoy seguro de mi fe y solo deseo compartirla con vosotros estoy orando por ustedes y espero no tener respuestas agresivas.
    Solo deseaba saludarles…
    atte Lic. Eduardo Cruz

  120. Walter says:

    Hola David:
    Disculpa por la demora en responderte, como estoy de vacaciones salí de viaje.
    Si sigues firme en tu afirmación pero no la sustentas, creo que te refieres a tu fe. Y ya te he comentado que ese es un aspecto que no me incumbe.
    Estoy totalmente de acuerdo que le personaje de Jesús puede partir de una figura real que fue mitificada. El asunto en debate es el Jesús DE LOS EVANGELIOS. La mitificación es evidente, el tema que trato de dilucidar en este foro es buscar las PRUEBAS de que fue una persona, varias personas o ninguna persona en particular sino la confusión de leyendas. He leído que es muy probable que muchos de los postulados atribuídos a Pitágoras no sean exclusivamente de él, sino que se le asignaran también ideas de otros matemáticos griegos. Y nadie se rasga las vestiduras por ello. En cambio en el caso de Jesús, la mayoría de creyentes se aferra a los evangelios pese a que reconocen que no son libros de historia, sino de mitología.
    Sobre lo que has ignorado, no necesito repetirlo, está en mis mensajes.
    Sobre el Papiro Rylands, solo te mencioné la razón que tenía el historiador que cite para afirmar que Juan era el más antiguo. No hay dogmas de fe, hay falta de evidencias por tanto las especulaciones pueden hacerse, válidamente, en varios sentidos.
    En cuanto al buen Asimov, estás confundiendo su libro Interpretación de la Biblia como si fuera un libro de HISTORIA. Pero, no lo es- Es la INTERPRETACION DE LA BIBLIA, no es su cotejo con las fuentes de la historia que la contradigan. Y por lo demás, ya te explique que Isaac Asimov, no hace afirmaciones como si fueran la ULTIMA PALABRA EN EL TEMA. Asimov, emite opiniones, como lo hacemos nosotros. Finalmente, las pruebas e la historicidad de Jesucristo a las que aludí anteriormente no son los decires de uno y otro escritor, son los documentos de la época, todo lo demás son especulaciones, porque las pruebas son por lo menos, insuficientes.
    Tu afirmación de que el perfil del Jesús evangélico no corresponde a la de un demente, adolece, para mí, de dos errores fundamentales: a) Tu aceptaste que los Evangelios son libros mitológicos, por tanto no prueban nada, b) En la lectura de los Evangelios a mí si me parece el perfil de un demente; el que a ti no te parezca ( o a mí sí) no son prueba de nada.
    Asi que si ya no tienes más pruebas, consideraré que desistes de afirmar que “La precedencia del mito de Jesús a la oficialización del cristianismo en el imperio romano prueba Que Jesús es histórico. Y lo dejamos allí.
    Un saludo
    Walter

  121. Walter says:

    Hola Eduardo:
    Un gusto que reaparezcas. Sobre tus comentarios parece que te quejaras de algo, ¿podrías ser específico? Por ejemplo puedes decirnos por qué crees que el foro se puede convertir en un círculo vicioso y como podemos evitarlo; qué te hace pensar que queremos ganar discusiones para demostrar que alguien es mejor si no nos conocemos más allá de nuestra opiniones; o ¿tal vez implicas que no es bueno saber y aprender?
    También podrías especificar quien y como trata de desacreditar o ridiculizar a quién. Al menos en mi caso, no me interesa quienes son los que envían opiniones en este foro, solo me centro en opiniones y no en las personas (y no podría ser diferente pues no conozco a nadie, ni es relevante)
    En cuanto a tu fe, tal como le dije a David, no me incumbe, por mi podrias creer en los platillos voladores; y tus oraciones tampoco significan nada para mi. Hay muchas personas buenas y razonables que no aceptan tu creencia; si quieres que otros la compartan tienes que convencerlos racionalmente, los rezos no bastan.
    Saludos cordiales,
    Walter

  122. Lic. Eduardo Cruz says:

    Hey tranquilo Walter…
    no se altere, creo que es usted el que se queja de algo.
    Pedone si le molestaron mis saludos.
    Su pregunta; ¿tal vez implicas que no es bueno saber y aprender?
    No llegue usted a conclusiones prematuras de especulación negativa
    pues no trato de fomentar la ignorancia
    de ninguna manera, solo que veo y leo sus comentarios y los de David
    (a quien también mando un cordial saludo)
    Por otro lado ¡nada que ver los platillos voladores con Jesucristo!
    por que no se trata de creer por creer (fe ciega o algo así)
    sino mas bien donde esta puesta mi fe.
    Si mis oraciones no significan nada para usted…
    lo significara pronto… creame
    Coincido con usted en que hay personas sinceramente equivocadas
    (como yo lo fui) que no aceptan (y tal vez nunca aceptaran)
    la creencia en la biblia o en Jesucristo…
    pero usar el adjetivo calificativo de “bueno” tan a la ligera…
    perdóneme pero yo lo considero muy osado de su parte.
    A lo mejor superficialmente rezar y orar es lo mismo pero no lo es…
    y también coincido con usted en decir que no basta con rezar u orar
    (que para usted es lo mismo)…
    hace falta la acción y el raciocinio lógico y creame que lo uso a diario.
    En la primera carta universal de Pedro cap3: verso 15 dice:
    … y estemos siempre preparados para presentar defensa con mansedumbre y reverencia ante todo aquel que nos demande razón de la esperanza que hay en nosotros…
    Saludos cordiales,
    Eduardo Cruz

  123. Lic. Eduardo Cruz says:

    Solo deseaba saludarles…
    Eduardo Cruz.

  124. Lic. Eduardo Cruz says:

    Pd. Ya estoy empezando a traducir la refutación del libro de J.M.D. de E.q.e.u.V. del ingles al español en la pagina que me dijo Walter…
    estamos en contacto…

  125. Walter says:

    Hola Eduardo:
    Estoy muy tranquilo. No me altero, ni me quejo, solo te pido que no lances comentarios sin fundamento. Tampoco me molestan tus saludos. Tampoco llego a conclusiones prematuras, solo te pregunto. Ni he hecho especulación negativa alguna, tu eres quien habla de fomentar la ignorancia, yo vengo al foro a aprender, y aunque no lo creas, de tus opiniones también aprendo.
    Mi pregunta sobre si insinuabas que no era bueno aprender es consecuencia de tu afirmación de que “la gente quiere presumir de saber más”; como si fuera malo saber, y lo peor es que no explicas donde, cómo, ni cuándo ocurrió eso.
    Creer en los platillos voladores y en Jesucristo son la misma cosa pues ambas son creencias sin fundamento, ambas parten de la fe, ambas carecen de pruebas válidas de que lo que afirman sea cierto. Si tu consideras que tu creencia la puedes sustentar con raciocinio lógico, hazlo, nada ganas sermoneando.
    También te has confundido cuando dices que coincides conmigo en que hay personas “sinceramente equivocadas que no aceptan la creencia en la Biblia o en Jesucristo” pues eso no es lo que yo dije, para mí la Biblia es un libro negativo y Jesús un mito.
    En cuanto a tus rezos (u oraciones, o ruegos, o súplicas, o como quieras llamar a tus comunicaciones inalámbricas imaginarias con tu dios inexistente) dije que no sirven para nada, y en eso sí estamos de acuerdo; pero luego “profetizas” que “ya significaran algo para mi” no entiendo a que te refieres, ¿podrías explicarte?
    Al pretender que la gente tenga que “aceptar” tus creencias; no piensas con “razonamiento lógico”, es absurdo esperar que porque tu crees algo todos tienen que creerlo; no puedes llamar a eso “razonamiento lógico”.
    Y cuando dices que me apresuro al hablar de “buenos”, cuando dije que hay muchas personas buenas y razonables que no aceptan tu creencia; por favor. Ilústrame en tu concepción del dogma cristiano: ¿Se condenarán eternamente todos los que no crean en tu Dios, así sean buenos? ¿PUEDE SER BUENO ALGUIEN QUE NO CREA EN TU DIOS?
    Y ya que citas la Biblia, me das oportunidad de responderte en tus propios términos:
    El tal Pedro también dijo: “los que en otro tiempo desobedecieron, cuando una vez esperaba la paciencia de Dios en los días de Noé, mientras se preparaba el arca, en la cual pocas personas, es decir, ocho, fueron salvadas por agua” (Pedro 3:20).
    ¿Que explicación puedes dar de esa acción de tu Dios que exterminó a todos los seres vivos del planeta, menos a 8 personas? Tu Dios asesinó a todos los seres humanos incluyendo a quienes ni sabían que existía el judaísmo, tu Dios asesinó a su pueblo escogido porque no se portaban como el quería; y extermino a los pueblos que no había escogido y que ni sabian de su existencia, tu Dios asesinó a todos los niños del planeta que no tenían culpa alguna, tu Dios asesinó a todos los animales, tu Dios sangunario y genocida exterminó toda la vida del planeta (‘menos a 8 personas!). Al menos así está escrito en tu “Sagrada” Biblia.
    Entonces, Eduardo, dime: ¿Qué explicación tienes para no avergonzarte de tu Dios sanguinario? y ¿Como puedes decir que ese Dios, asesino convicto y confeso, es “Amor”?
    Saludos,
    Walter

  126. Lic. Eduardo Cruz says:

    tranquilo de nuevo,
    espero que haya tenido unas felices vacaciones Walter.
    cuidese…

  127. Walter says:

    Gracias.
    Walter

  128. david says:

    Hola Walter:
    Yo también he estado de viajes de estudios, así que te respondo ahora.
    Está claro que existió una persona llamada Jesús, que predicó una doctrina de amor al prójimo y que criticaba al sistema religioso de su tiempo. También de que fue crucificado por orden de Poncio Pilatos.
    No digo que la precedencia del “mito” de Jesús a la oficialización de la religión cristiana por Roma demuestre que Jesús sea histórico, sino que es un despropósito afirmar que para conocer el dogma de un mesías llamado por ese nombre haya que conocer la historia del imperio romano.
    Por último, dices que el perfil del Jesús bíblico te parece el de un demente. Ya me explicarás por qué.
    Por lo demás, estoy de acuerdo con las otras afirmaciones.
    Un saludo

  129. Walter says:

    Hola David:
    Bueno, todos tus argumentos para probar la historicidad de Jesús los has desestimado.
    Has reconocido que ni Tácito, ni las cartas paulinas, ni la precedencia del mito de Jesús prueban que haya existido Jesucristo. Dices también que es un “despropósito” estudiar la Historia de Roma para conocer el origen del mito de Jesús que surgió y se impuso en el ámbito del Imperio Romano; bueno, huelgan comentarios. Entonces, ¿En que te basas para seguir afirmando su existencia? ¿Tienes alguna otra prueba?
    Lo del demente Jesús, es sencillo y tu mismo pusiste los parámetros y el ejemplo: Si una persona nos dice que es “el hijo de dios” o “que hace milagros” o “que va a resucitar”; lo llamaríamos demente. Por ejemplo, David Koresh se declaró hijo de Dios y murió quemado en Waco (USA). Los seguidores de Koresh tienen fe en que su loco era el “Hijo de Dios”. Los seguidores de Jesús también creen que su loco era el Hijo de Dios. El loco Koresh es historia reciente y la conocemos por muchos medios y no por los Evangelios de la Secta Davidiana; en el caso del loco Jesús solo conocemos lo que dicen los inverosímiles Evangelios de la Secta Cristiana. Claro, que puedes argumentar desviando el asunto que “Jesús no dijo que era Hijo de Dios”, pero si llegamos a ese punto en realidad Jesús no dijo absolutamente nada. Los Evangelios y toda la Biblia son puros cuentos.
    Walter

  130. Lic. Eduardo Cruz says:

    Efectivamente; solo un loco o un necio declararia unos dias antes de morir, que volveria a vivir o a resucitar despues de su propia muerte….
    a menos, claro que realmente supiera que sucedería…
    y sucedio…
    que le vamos a hacer?

  131. david says:

    Walter:
    Yo no he desacreditado el testimonio de Tácito.
    Jesucristo no es un demente, contestaba a todas las cuestiones que se le planteaban con gran sabiduría, sin rastro de fanatismo (incluso aquellas que se le planteaban para tenderle una trampa).
    El Jesucristo bíblico resucitó, luego no era un demente.

  132. Lic. Eduardo Cruz says:

    Si usted realmente afirma haber leído el ¨librito¨ de Josh Mc Dowell y a sus refutadores,
    me sorprende pues que haga usted tales afirmaciones conclusivas sobre la no existencia de Jesucristo.
    Además en la nueva revisión del libro incluye el tomo 1 (ya revisado), el 2 (también revisado) y…
    ¿que cree?
    también las respuestas a sus refutadores.
    Así como también provee mas evidencias importantes que han ocurrido en el transcurso de los últimos 20 años por ejemplo los nuevos descubrimientos arqueológicos que han agregado confirmación adicional a la credibilidad bíblica.
    PD.
    Fue editado y publicado en 2004;
    (mientras que sus refutadores
    se quedaron unos años atras )

  133. Walter says:

    Hola David:
    La “sabiduría de las respuestas” de un orate que se cree Dios, no prueban que no está loco; Decir que las respuestas son “sabias” es una apreciación subjetiva y es lo mismo que deben pensar los seguidores de David Koresh sobre las enseñanzas de su lider.
    Y lo de la “resurrección” no es serio y acaba de un plumazo con nuestra conversación abandonando el mundo real, la lógica y el racionalismo, para entra en el mundo del “todo vale”. Y en cuanto a la demencia, hablar de “muertos que resucitan” me parece por el contrario una prueba de las tendencias esquizofrenicas o excesos imaginativos de los que escribieron el cuento evangelico, pudieron escribir el guión de “El Regreso de los Muertos Vivientes”.
    Antes de entrar en el tema del “testimonio” de Tácito, sería bueno que digas si esa es tu única prueba o tienes otras mas. En todo caso ¿Podrías decirme si Tacito también es tu prueba de la resurreccion de Jesus?
    Ten en cuenta que no esta en debate Tacito como historiador, ni su obra en general, sino sólo el dudoso e insignificante texto seudo-probatorio de Jesus que dice:
    “Por lo tanto, para cortar el rumor, Nerón substituyó como culpables, y castigó con los refinamientos más extremos de crueldad, una clase de hombres, aborrecidos para sus vicios, que la muchedumbre llamaba Cristianos. Cristo, el fundador del nombre, había sufrido la pena de muerte en el reinado de Tiberio, por la sentencia del procurador Poncio Pilatos… ”
    Si esa es tu única prueba histórica de que el Jesus de los Evangelios ha existido ¿Crees realmente que ese pequeño parrafo, unico en medio de la voluminosa obra de Tacito, permita deducir que todo lo que dicen los evangelios sobre Jesus es cierto?
    Bueno, entremos en materia: El parrafo tiene, por lo menos, dos tipòs de cuestionamiento
    1) Que sea un fraude cristiano posterior (estilo Josefo y otros ya comprobados) y
    2) Que carezca de valor històrico porque Tacito repita lo que dicen los propios cristianos y no provenga su información de los registros romanos:
    1) Si no es un fraude posterior:
    a) ¿Por qué Tacito no vuelve a aludir a las persecuciones de cristianos en cualquiera de sus voluminosos escritos y solo existe el escueto texto citado?
    b) Por qué ni Clemente de Alejandría ni Tertuliano que escribieron historia y apologetica cristiana en el siglo III y que citan mucho a Tacito no mencionan el parrafo sobre Cristo y las persecuciones neronianas?
    2) Si Tacito tiene una fuente fidedigna romana y no está repitiendo lo que dicen los cristianos;
    2a)¿Porqué llama Procurador a Pilatos cuando su cargo era en realidad de Prefecto?.
    2b) ¿Porqué no usa el nombre propio de Jesús para designar al hombre ejecutado? ¿Por qué en cambio se refiere a un título elogioso de Mesías, es decir “el Elegido”, tìtulo que no podrían haber usado los romanos en sus documentos oficiales?
    Saludos,
    Walter

  134. Walter says:

    Hola Eduardo:
    Tienes razón, no he leído el nuevo libro de JMD. ¿Podrías explicarme en que consisten esas nuevas evidencias importantes aparecidas en los últimos 20 años?, y también ¿cuales son los descubrimientos arqueológicos que han “agregado” confirmación adicional a la credibilidad bíblica?. En este último aspecto, arqueológico, podrías decirme también cuales pruebas había antes de que se agreguen las últimas que mencionas.
    Me interesa mucho conocerlas, especialmente porque todas las argumentaciones que pasaste anteriormente carecían de valor probatorio y fueron categóricamente refutadas.
    Saludos cordiales,
    Walter
    Nota; ¿Realmente crees que los muertos pueden resucitar?¿Crees también que las culebras o las mulas pueden hablar?¿Crees que Jesus nacio del cruce de una mujer con una Paloma?¿Crees que no es politeísmo creer en 3 dioses en uno? ¿Te conformas con aceptar el galimatias del misterio de la Trinidad como “un misterio”?¿Crees que el mundo se hizo en 6 días? Te hago esas preguntas pues los conceptos pertenecen a tu dogma religioso y no por ofenderte. Me interesa saber que piensas.

  135. david says:

    Hola Walter:
    Sigo creyendo que Tácito no es la única prueba de la existencia de Jesús.
    También creo que hay una referencia en las Antigüedades de los judíos de Josefo.
    Tácito: El texto señala que los cristianos eran originarios de Judea, que su fundador había sido un tal Cristo resulta más dudoso saber si Tácito consideró la mencionada palabra como título o como nombre propio ejecutado por Pilato y que durante el principado de Nerón sus seguidores ya estaban afincados en Roma donde no eran precisamente populares.
    Suetonio: Suetonio menciona una medida del emperador Claudio encaminada a expulsar de Roma a unos judíos que causaban tumultos a causa de un tal “Cresto”. Los datos coinciden con lo consignado en algunas fuentes cristianas que se refieren a una temprana presencia de cristianos en Roma y al hecho de que en un porcentaje muy elevado eran judíos en aquellos primeros años. Por añadidura, el pasaje parece concordar con lo relatado en Hechos 18, 2 y podría referirse a una expulsión que, según Orosio (VII, 6, 15) tuvo lugar en el noveno año del reinado de Claudio (49 d. de C.). En cualquier caso no pudo ser posterior al año 52.
    Ninguno de los dos pasajes de las Antigüedades relativos al objeto de nuestro estudio es aceptado de manera generalizada como auténtico, aunque es muy común aceptar la autenticidad del segundo texto y rechazar la del primero en todo o en parte. El hecho de que Josefo hablara en Ant XX de Santiago como “hermano de Jesús llamado Mesías” una referencia tan magra y neutral que no podría haber surgido de un interpolador cristiano hace pensar que había hecho referencia a Jesús previamente. Esa referencia anterior acerca de Jesús sería la de Ant XVIII 3, 3. La autenticidad de este pasaje no fue cuestionada prácticamente hasta el siglo XIX ya que, sin excepción, todos los manuscritos que nos han llegado lo contienen. Tanto la limitación de Jesús a una mera condición humana como la ausencia de otros apelativos hace prácticamente imposible que su origen sea el de un interpolador cristiano. Además, la expresión tiene paralelos en el mismo Josefo (Ant XVIII 2, 7; X 11, 2). Seguramente también es auténtico el relato de la muerte de Jesús, en el que se menciona la responsabilidad de los saduceos en la misma y se descarga la culpa sobre Pilato, algo que ningún evangelista (no digamos cristianos posteriores) estaría dispuesto a afirmar de forma tan tajante, pero que sería lógico en un fariseo como Josefo y más si no simpatizaba con los cristianos y se sentía inclinado a presentarlos bajo una luz desfavorable ante un público romano.
    Otros aspectos del texto apuntan asimismo a un origen josefino: la referencia a los saduceos como “los primeros entre nosotros”; la descripción de los cristianos como “tribu” (algo no necesariamente peyorativo) (Comp. con Guerra III, 8, 3; VII, 8, 6); etc. Resulta, por lo tanto, muy posible que Josefo incluyera en las Antigüedades una referencia a Jesús como un “hombre sabio”, cuya muerte, instada por los saduceos, fue ejecutada por Pilato, y cuyos seguidores seguían existiendo hasta la fecha en que Josefo escribía. Más dudosa resulta la clara afirmación de que Jesús “era el Mesías” (Cristo); las palabras “si es que puede llamársele hombre”; la referencia como “maestro de gentes que aceptan la verdad con placer” posiblemente sea también auténtica en su origen si bien en la misma podría haberse deslizado un error textual al confundir (intencionadamente o no) el copista la palabra TAAEZE con TÁLESE; y la mención de la resurrección de Jesús. En resumen, podemos señalar que el retrato acerca de Jesús que Josefo reflejó originalmente pudo ser muy similar al que señalamos a continuación: Jesús era un hombre sabio, que atrajo en pos de si a mucha gente, si bien la misma estaba guiada más por un gusto hacia lo novedoso (o espectacular) que por una disposición profunda hacia la verdad. Se decía que era el Mesías y, presumiblemente por ello, los miembros de la clase sacerdotal decidieron acabar con él entregándolo con esta finalidad a Pilato que lo crucificó. Pese a todo, sus seguidores, llamados cristianos a causa de las pretensiones mesiánicas de su maestro, DIJERON que se les había aparecido. En el año 62, un hermano de Jesús, llamado Santiago, fue ejecutado además por Anano si bien, en esta ocasión, la muerte no contó con el apoyo de los ocupantes sino que tuvo lugar aprovechando un vacío de poder romano en la región. Tampoco esta muerte había conseguido acabar con el movimiento.
    Resurrección:Puede ser que en una época de raciocinio no se pueda hablar de milagros y de resurrección. Pero los creyentes si creemos que los muertos puedan resucitar. Se ha dado explicaciones científicas a la división en dos bloques del mar de los Juncos (éxodo), a las sanaciones (psicosomático), y puede que algún día se pueda hablar de resurrección. Por otro lado, no creo que la resurrección de Jesús sea fruto de una esquizofrenia ni de un invento de sus seguidores.
    Si fue un invento, habían traicionado a su maestro, por que este les enseñó a decir la verdad ante todo.
    En los evangelios, refleja el estado en desánimo de sus discípulos, que lo abandonaron cuando los levitas y los romanos lo prendieron. No veo a los discípulos con mucho ánimo para inventarse historias.
    De todas formas, si fue un invento, las autoridades religiosas y políticas pudieron haberlo desmentido mostrando su tumba (esto mismo ocurrió con otros falsos mesíAS).
    Adversarios al cristianismo, afirmaron lo mismo como Pablo de Tarso. Muchos afirman que éste era un epiléptico, pero la constitución física de Pablo era demasiado fuerte para un epiléptico. Sufrió lapidaciones, naufragios, etc. También Asimov descarta esa teoría.
    Y los discípulos muy dificilmente hubieran robado el cuerpo, ya que dos soldados vigilaban la entrada a la cueva.
    Un saludo

  136. david says:

    En palabras del propio Gordon Stein: “Hay muchos académicos que sostienen que puede haber un núcleo auténtico sobre Jesús en el pasaje original y que fue reformado por los Cristianos, pero también hay una gran cantidad de eruditos que piensan que todo el pasaje es un fraude, o sea que las opiniones están divididas. ”
    “Así, de ninguna manera es honesto presentar este pasaje como evidencia histórica de algún hecho, pues es obvio que fue interpolado, al menos parcialmente por cristianos.”
    Pero lo mismo se puede decir de presentarlo como “no-prueba”.

  137. Walter says:

    Hola David:
    ¿Podrías decirme que opinas sobre los argumentos que ponen en duda la autenticidad del breve párrafo de Tácito sobre Jesús y que detalle en mensaje anterior?
    Tus “evidencias de la historicidad de Jesucristo”, Josefo, Tacito y Suetonio, se componen en conjunto de unas 20 líneas de dudoso origen, unas atribuidas a Josefo y que son un probado fraude, y las restantes escritas casi un siglo después por 2 historiadores romanos, uno de ellos se basa en el mejor de los casos, en las tradiciones orales de los propios cristianos, que no tocan ningún detalle de la vida real de un tal Jesús, y ni siquiera menciona su nombre; y el otro historiador no habla de Jesús sino de un tal Crestus agitando en Roma.
    En el caso de Josefo, creo que reconoces que el “testimonio flaviano” es un fraude pero insististes en que el otro pasaje sobre “el hermano de Jesús” es un poco menos fraude, o de que una línea dudosa prueba que Santiago era hermano del Jesús, etc., son especulaciones y no pruebas contundentes de que la historia de los Evangelios sea cierta. Igual son especulativas tus explicaciones sobre “lo que debía decir Josefo si no lo hubieran adulterado” ¿Esas son tus pruebas que Jesús es un personaje histórico?
    En el caso de Tacito, primero te fuiste por las ramas de las persecuciones romanas y dijiste que no afirmabas que eso probara que Jesús era histórico. Ahora vuelves con Tacito pero terminas afirmando que Tácito prueba que había cristianos en Roma, pero ¿Prueba eso que Jesús es histórico?
    En lo de Suetonio dijiste que el historiador se equivoco de nombre, el agitador Crestas no estaba vivo sino que era Cristo como dios invocado por los revoltosos,etc. creo que allí te olvidaste de la Razuradora de Occam, la explicación simple es que Suetonio NO se refiere a Jesús. Nuevamente tus explicaciones son especulativas. Y aún aceptando tu especulación, la cita probaría que había cristianos en Roma, pero ¿Eso prueba que Jesucristo es histórico?
    Olvidas que hablamos de historia y sigues fundamentando tus argumentos en las fabulas de los Evangelios ¿recuerdas que aceptaste que los Evangelios no eran libros de historia? Entonces ¿porque sigues refiriendote a cuentos que solo existen como parte de tu fe en el dogma judeo-cristiano. Sabes que como tal carecen de sustento racional para discutirlas y me parece poco serio que hables de “resurrección”, y demás cuentos del imaginario mundo bíblico y es poco ético que incluyas en el debate las maravillas sobrenaturales y excelsas cualidades de un personaje cuya existencia no has podido probar.
    Finalmente, a tu pregunta anterior de porque creo que prefieres el esoterismo, me parece que tu mismo la has respondido con tus últimos comentarios.
    Saludos cordiales,
    Walter

  138. nestor rafael says:

    la verdadera ciencia es la que busca la verdad y que entrege esta verdad al mundo. la verdadera religion es la que unifica
    a la gente sin un dios por intermedio

  139. Walter says:

    Hola Nestor;
    ¿Podrias ser más específico? Es cierto que la ciencia busca la verdad, y eso es lo que nos lleva a los dialogos de este foro. Pero, de donde sacas que la verdadera religión es la que unifica, ¿Cuál es la verdadera religióm? y ¿qué es lo que unifica? ¿De qué hablas? Es tu religión la verdaddera por que tu lo dices? ¿Y que tiene que ver un Dios (ente imaginario) en el asunto?
    Tu sabes que no todos comparten tu creencia y no es racional que esperes que la aceptemos solo porque tu lo dices.
    Convencenos de que tienes razòn, Te esperamos.
    Walter

  140. david says:

    Walter:
    El texto de Tácito no está considerado un fraude, ni tampoco sus persecuciones a los cristianos.
    Tampoco carece de valor histórico, pues si Tácito hubiera tan sólo seguido los testimonios cristianos, hubiera dicho, “según dicen los cristianos”, “los cristianos creen”, etc.
    Emplea el título con que fue condenado por Pilatos , “Cristos”.
    Según la Wikipedia, no era Pilatos un prefecto, sino un procurador.
    Vuelvo a repetir, que no es la única prueba de las persecuciones de Nerón a los cristianos, sino que existe otra referencia de Suetonio (y aquí habla claramente de cristianos)
    Josefo: El texto de Josefo sigue siendo objeto de controversia. Historiadores afirman que hay un núcleo que luego fue reforzado por los cristianos, y otros que es por completo un fraude. Luego, no se puede condenar y decir con toda seguridad que es un fraude.No sé si habrás leido mi comentario anterior sobre Josefo.
    Suetonio: No he dicho que Suetonio pruebe la existencia de Cristo, sino que éste lo menciona.Dices que me olvidé de la navaja de Occam, pero digo yo, ¿Quién era Crestus?
    Ahora te hago otras preguntas:
    1. ¿Por qué esforzarse en decir que eran crestianos, sabiendo que se trata de una palabra peyorativa para referirse a los esclavos, entre los cuales el cristianismo estaba surgiendo efecto?
    2. ¿Por qué contradecir lo que es reforzado por otras fuentes como Hechos 18, 2, y Orosio; que afirman que había una minoría de cristianos en Roma y un gran número de judíos?
    3.¿No te parece demasiada casualidad que el texto de Suetonio coincida con el de Tácito?
    4.¿Quién era Crestus y por qué no tenemos noticias de él?
    5.¿Qué hay de la expulsión de los cristianos por parte de Claudio que menciona Orosio?
    Un saludo

  141. Walter says:

    Hola David:
    ¿Tacito y Suetonio prueban que Jesús es histórico? Hasta ahora solo has repetido que prueban que había cristianos en Roma en el siglo II. Ya antes te expliqué que el hecho de que haya cristianos no prueba que Cristo sea histórico, para la creencia basta el mito.
    Lo de Josefo, ¿Podrías llamar prueba de la existencia de Jesús a una dudosa especulación sobre un conocido fraude?
    Y haciendo una evaluación del tema ¿Esas son tus únicas pruebas? ¿No te parecen insignificantes frente a los montones de volumenes de historia de la época? Y conste que según los evangelios Jesús convocaba multitudes con su milagros y enseñanzas, ¿Como podría pasar desapercibido un personaje tan espectacular?
    Ahora respondo a tus preguntas:
    1) No hay ningún esfuerzo en llamar cristianos a los cristianos; y no veo que eso tenga nada que ver con la historicidad de Jesucristo.
    2) Nadie contradice que había cristianos y judíos en Roma en el siglo II.
    3) No veo la coincidencia pues hablan de personas diferentes. Lo de igualar un Cristo muerto que nunca estuvo en Roma, con un Crestus vivo agitando en Roma un siglo despues, es una especulación conveniente de los creyentes pero no es lo que dice Suetonio.
    4) No solo no tenemos más noticias del tal Crestus, tampoco hay más noticias del tal Cristo. (aparte claro de las historias inventadas por los propios cristianos)
    5) Sobre la expulsión de los cristianos no conozco mucho y no me parece que tenga nada que ver con el tema que tratamos que es probar que Jesús existió realmente. Si me dices como la expulsión se vuelve prueba, la estudiare.
    Para que veas que NO ESTA NADA CLARO (salvo para ti) que Jesús sea un personaje histórico de carne y hueso y para que no pienses que soy el único que tiene dudas de su existencia histórica ni que lo hago por ganar discusiones o por herejía, jajaja, te paso a continuación un resumen de algunas opiniones de estudiosos del tema:
    Earl Doherty (Challenging the Verdict: A Cross-Examination of Lee Strobel’s “The Case for Christ * The Jesus Puzzle: Did Christianity begin with a mythical Christ? * Historical Jesus or Jesus Myth? The Jesus Puzzle)
    Earl Doherty Sostiene que el cristianismo surgió con un Jesús mitológico. El cristianismo primitivo puede explicarse como descendiente de las especulaciones místicas sobre las escrituras judías (que se encuentran en escritos como los de Filón de Alejandría) y su combinación con las ideas helenísticas y platónicas de la época. El otro componente del pensamiento cristiano primitivo proviene de las prédicas sirio palestinas de expresiones de sabiduría de origen anónimo y que se denominan Q. Posteriormente se le agregarán a tales expresiones la frase inicial “Jesús dijo”. Pablo solo habla de un Jesucristo místico. La narrativa de Marcos (85-90 DC) recién le da una versión humana a la “Pasión de Jesús”. Sobre la base de Marcos y retazos de Q, Mateo en 100 DC, Juan entre el 90 y el 100 DC y Lucas alrededor del 125 DC escriben sus biografías de Jesús agregando detalles inventados que convienen a la evolución del credo. Coexistieron diversos evangelios contradictorios hasta la oficializacion del cristianismo. Aunque aún en el siglo II había cristianos que defendían el concepto del Jesús solo divino, la mitología evangélica terminó por dominar.
    Alvar Ellegård (* Jesus : One Hundred Years Before Christ)
    Ellegard sostiene que el cristianismo surgió de la iglesia Esenia. Pablo y otros evangelizadores convierten al líder esenio muerto un siglo atras, llamado “El Maestro de Rectitud” en los escritos de Qunram, y lo convierten en el Mesías celestial, en el Salvador, de esa denominación viene el nombre “Jesús” y es como se empieza a denominar al Mesías. Diversos documentos del cristianismo primitivo están mal fechados, por ejemplo, “Las Revelaciones” de Juan, la Carta a los Hebreos, el Didache, la Carta de Barnabas, son contemporáneas a Pablo; y los escritos de Ignacio representan un punto intermedio entre Pablo y los Evangelios, que fueron escritos bien entrado el siglo II. La historia de Jesús y su crucifixión por Pilatos es pura ficción.
    Timothy Freke y Peter Gandy (# The Jesus Mysteries : Was the “Original Jesus” a Pagan God (Three Rivers Pr 2001) # Jesus and the Lost Goddess : The Secret Teachings of the Original Christians (Harmony Books 2001) # CNN: Raising a holy ruckus
    Sostienen que el cristianismo es una variante del gnosticismo que desarrolló los Misterios Eleusinos con el mito recurrente de la muerte y resurrección del hombre-dios. Los posteriores evangelistas consideraron que el Mesías debía ser una figura histórica y no mítica, así que inventaron la biografía, ajustándola al tiempo y espacio conveniente para que parezca una historia real. Era mucho más creíble una religión que se basara en hechos realmente ocurridos que la fe ciega en mitos. La leyenda de Jesús se forma de la fusión de los mitos de Osiris y Dioniso.
    Walter
    NOta: Me parece lamentable que pese a que te detallé las razones que había para dudar de la mención de Tacito, no toques el tema y repitas sin argumentar que “no es considerado un fraude”, ¿es también con fe que o decides?

  142. david says:

    Hola Walter:
    Jesucristo, ¿fue un mito esenio?
    No al menos el Jesús que narra los evangelios.
    La documentación que tenemos acerca del culto esenio, y de los evangelios nos indica lo contrario.
    Los esenios (así aparece en su obra Rollo de la guerra) creían en la guerra santa y se preparaban para ese momento. Jesús de Nazaret fue lo opuesto a la violencia.
    Los hombres de Qumrán eran la derecha de la derecha religiosa, en clara oposición al culto y al templo de Jerusalén. Esta fue una de las razones por la que se exiliaron en el Mar Muerto. Jesús, sencillamente, no tomó partido por nadie, aunque acató el culto establecido.
    La comunidad de Qumrán estableció una normativa interna de auténtica pesadilla. El Maestro jamás dictó normas.
    Los esenios se regían por el calendario solar. Jesús, con toda probabilidad, practicó el lunar (354 días), al igual que el resto de la comunidad judía. .
    En el Rollo de Cobre, los esenios proporcionan pistas sobre un gran tesoro que no ha sido hallado. A Jesús jamás le interesaron esas riquezas.
    En otra de las obras escritas por los esenios -el Rollo del Templo- se explica cómo debe ser el nuevo Templo de Israel.
    Jesús nunca predicó la necesidad de un nuevo templo.
    Los esenios se consideraban elegidos. Sus principios teológicos sobre los hijos de la luz y los hijos de las tinieblas estaban fundamentados en la supremacía racial del grupo. Para Jesús de Nazaret, todos los hombres son iguales.
    Los monjes de Qumrán jamás se dirigían a Dios como Padre (“Ab-bá”). Hubiera sido una blasfemia. “Ab-bá”, en cambio, es la palabra más utilizada por el Maestro.
    Los esenios esperaban a un Mesías que debía jugar un doble papel: sacerdote y libertador político. Jesús no fue ni lo uno ni lo otro.
    Los esenios creían en el regreso de un Maestro de Justicia. Si Jesús hubiera sido identificado como dicho personaje, ¿lo hubieran dejado morir?
    Para ingresar un Qumrán se exigía un doble periodo de prueba. En total, dos años. Jesús nunca puso a prueba a sus discípulos.
    Los esenios no admitían a enfermos y lisiados. Jesús de Nazaret era, justamente, lo contrario.
    Una vez superado el periodo de prueba, el nuevo esenio se hallaba sujeto a la autoridad del Consejo, a las reglas establecidas en el manual, al criterio de los sacerdotes, etcétera. Nada de esto sucedió con Jesús.
    Los esenios evitaban las relaciones con los gentiles, en especial con los romanos. Jesús se mezcló con todos.
    En la comuna de Qumrán estaba prohibido untar el cuerpo con aceite y cambiar de vestido y de calzado. Sin comentarios.
    Los esenios concedían una especial importancia a la astrología. Que yo sepa, Jesús nunca se pronunció sobre el particular.
    Para Qumrán, el final de los tiempos era inminente. Y así lo reflejan en sus escrituras. Cuando el Hijo del Hombre fue preguntado sobre el final de los tiempos, la respuesta no debió gustar a los esenios: “Salvo el Padre, nadie sabe sobre ese día…”
    Queda descartada tal posibilidad.
    Tácito; no se ha cuestionado la autenticidad de su comentario de los Anales, excepto por Gordon Stein y sus fuentes. Quien niegue las persecuciones de Nerón a los cristianos, no merece mi fiabilidad. Está demostrado que existieron y también el incendio de Roma.
    No sólo esto demuestra Tácito, sino la presencia de Cristo en la historia. Si hubiera dicho simplemente lo que creían los cristianos, lo hubiera expresado claramente (no sé yo quien se olvida de la navaja de Occam).
    Y si he tocado los temas que has mencionado, sobre la fiabilidad de Tácito.
    En cuanto a las demás posibilidades sobre el misticismo de Jesús, ya las leeré y analizaré tranquilamente.
    Un saludo

  143. david says:

    Sobre la teoría de Timothy Freke y Peter Gandy :
    El valor de los Evangelios apócrifos – como percibe cualquiera que los lee – es escaso sobre todo por los elementos legendarios y maravillosos que incluyen. Seguramente, aquí y allí aparecen datos valiosos pero de manera escasa. En relación con el reconocimiento de unos Evangelios y el rechazo de otros, el elemento de discriminación fue obvio: los canónicos recogían datos de apóstoles o de discípulos de apóstoles. No podía decirse lo mismo de los apócrifos que además son muy tardíos.
    Las sectas pseudocristianas aparecen en torno al siglo IV.
    Un saludo

  144. david says:

    Sobre el Documento Q:
    ¿Podemos asegurar que los Evangelios contienen palabras literales de Jesús de Nazaret?
    Hay que distinguir entre frases y frases. Algunas que por el trasfondo arameo, o por coherencia con la época en la que vivió Jesús se deduce que son claramente, al menos, de su tiempo, del núcleo del evangelio, lo que se llama documento “Q”. Hay otro tipo de palabras, especialmente las que llegan a través de la corriente jónica, de los escritos del cuarto evangelio, en los que la palabra de Jesús ha quedado revestida de un lenguaje más teológico y que, por lo tanto, es posterior.

  145. Walter says:

    Hola David:
    No respondiste a los cuestionamientos de la cita de Tacito, aqui te los repito:
    1) Si no es un fraude posterior:
    a) ¿Por qué Tacito no vuelve a aludir a las persecuciones de cristianos en cualquiera de sus voluminosos escritos y solo existe el escueto texto citado? Si crees que si lo hace, podrias decirme donde.
    b) Por qué ni Clemente de Alejandría ni Tertuliano que escribieron historia y apologetica cristiana en el siglo III y que citan mucho a Tacito no mencionan el parrafo sobre Cristo y las persecuciones neronianas?
    2) Si Tacito tiene una fuente fidedigna romana y no está repitiendo lo que dicen los cristianos;
    2a)¿Porqué llama Procurador a Pilatos cuando su cargo era en realidad de Prefecto?. * En 1961, en Cesarea Marina, encontraron una lapida de Poncio Pilatos en que aparece su cargo: “Prefecto”, y no “Procurador” que es un cargo que se usaba en el siglo II. Aparece en Wikipedia en ingles.*
    2b) ¿Porqué no usa el nombre propio de Jesús para designar al hombre ejecutado? ¿Por qué Tacito se refiere a un título elogioso de Mesías, que quiere decir “el Elegido”, es un tìtulo que NO podrían haber usado los romanos en sus documentos oficiales?
    * Dijiste que Tacito usaba el nombre Cristo pues era el nombre con que lo habian ejecutado, te pregunto, ¿COMO LO SABE TACITO?
    No te puse las teorías sobre el mito de Jesús para discutirlas en detalle sino para probarte que no es solo Gordon Stein “y sus fuentes” quien sostiene la falta de historicidad de Jesus. Tus INDOCUMENTADAS respuestas “¡descartando!” parte de los postulados que te pase son igual de especulativas.
    Y aquí va otro autor:
    Robert M. Price
    Professor of Theology and Scriptural Studies, Johnnie Colemon Theological Seminary; Editor, The Journal of Higher Criticism
    1) La vida de Jesús que se relata en los Evangelios corresponde al héroe arquetípico y mitológico de diferentes culturas. Su nacimiento supernatural, anunciado con antelación, el niño héroe que escapa de ser asesinado, la sabiduría precoz que exhibe desde pequeño, el encargo divino que recibe, derrota demonios, obtiene aclamación, es vitoreado como rey, después traicionado, pierde el favor popular y es ejecutado, generalmente en una colina o un árbol, pero finalmente es reivindicado y llevado al cielo. Es el argumento central de la historia de Hércules, de Apolonio de Tyana, de Padma Sambhava, de Gautama Buda, etc.y sobre los que generalmente los historiadores asumen que una figura histórica se ha convertido en un mito. En el caso de Jesucristo, virtualmente cada detalle de su vida corresponde al ser mitológico y no hay datos biográficos seculares de ningún tipo, por lo que resulta arbitrario afirmar que .se mitificó a una persona real. Podría haber existido un núcleo histórico pero no hay indicios sobre los cuales apoyar tal posibilidad y los historiadores no pueden basarse en la imaginación. Podría haber un personaje real detrás de la leyenda del Rey Arturo pero al igual que en el caso de Jesús, no hay una base racional para afirmarlo.
    2) La historia de la Pasión que se relata en los Evangelios es demasiado similar a mitos contemporáneos de muerte y resurrección de dioses salvadores, tales son los casos de Osiris, Tammuz, Baal, Attis, Adonis, Hércules y Asclepio. Igual que en la historia de Jesús, había gente que creía que habían existido realmente, que habían muerto y resucitado. Sus muertes y resurrecciones eran celebrados ritualmente cada primavera anunciando el retorno de la vida en la vegetación. En muchos mitos el cuerpo del salvador es ungido para el funeral, llorado por mujeres santas, para resucitar unos días después.
    3) De igual manera, el relato de la crucifixión, entierro y resurrección tienen sorprendente similitud con novelas populares de la época, con personajes que mueren, son condenados a la cruz, resucitan y van al cielo. Los apologistas refutan estas coincidencias afirmando que los otros mitos se han copiado de los Evangelios y que estos son la historia original, pero si bien hay historias similares del siglo II también los hay anteriores al cristianismo. Y es significativo que los apologistas del cristianismo primitivo argumentaran que esos mitos similares anteriores a los evangelios eran falsificaciones por adelantado hechas por Satán que sabía que la historia verdadera iba a ocurrir en el futuro y quería desacreditarla.
    4) Las epístolas del Nuevo Testamento pueden ser leídas con naturalidad si presumimos que en su tiempo aún no creían que su Dios salvador había sido una persona de carne y hueso que había vivido hacia pocos años. Por ejemplo Pablo nunca menciona a Jesús como maestro o hacedor de milagros. Pablo atribuye la muerte de Jesús, no a los romanos ni a los judíos sino a los designios de ángeles malignos que rigen el mundo. Inclusive dice Pablo que las autoridades romanas nunca castigan al recto sino solo al corrupto, ¿Cómo podría decir eso si conociera la historia de Pilatos y la ejecución de Jesús? Los apologistas se defienden citando Tesalonicenses y Timoteo que si mencionan a Pilatos, pero no dicen que son epístolas cuya composición es posterior a los Evangelios.
    5) Jesús es eventualmente humanizado y convertido en un personaje histórico del pasado, de la misma forma que había ocurrido antes con otras deidades judías como Sanson, Enoch, Jabal, Gad, Josué, etc. Como parte de este proceso hay varios intentos independientes de ubicar a Jesús en la historia reciente, por ejemplo al culpar de su muerte a tiranos conocidos como Herodes Antipas, Poncio Pilatos y hasta Alejandro Janeo que vivió en el siglo I AC. Si realmente la historia de Jesús proviniera de testigos presenciales no habría tantas versiones que difirieran en un punto tan central. Igual ocurre con los escritos cristianos que contienen más información sobre Jesús mientras mas se alejan en el tiempo de la época de su supuesta existencia y generalmente se agregan no hechos históricos sino citas o cumplimientos de profecías bíblicas.
    6) Los Evangelios son mitos no porque partamos de un prejuicio contra los milagros sino por un elemental principio de analogía con la experiencia que vivimos en nuestros días. No tenemos razón para pensar que las leyes de la naturaleza se comportaron diferente en el pasado.
    7) Los apologistas dicen que hubo muy poco tiempo entre la muerte de Jesús y la escritura de los evangelios para que se desarrolle una leyenda, pero si se presupone que Jesús existió en épocas de Pilatos, 40 años es suficiente para la expansión de una leyenda. Y en caso de que Jesús no existiera históricamente le tiempo de expansión es aún mayor.
    8) También debe tomarse nota que aún el caso de información procedente de testigos de eventos inusuales tiende a distorsionarse por la subjetividad del observador y generalmente no son confiables los testimonios que carecen de corroboración.
    Saludos cordiales,
    Walter
    Nota: Te agradeceria mucho que cuando respondas mis argumentos no escojas una u otra parte suelta de los mismos para comentar sino que refutes el conjunto, y que te centres en la historicidad de Jesus. Gracias.

  146. nestor rafael says:

    cuando me referi a dios lo hice para dar a entender que no lo necesitamos para dirigir nuestras vidas, que no esperemos de el lo que buscamos, si no que tenemos el suficiente poder para alcanzar nuestras metas ¿estamos de acuerdo? para mi esa es la verdadera religion, es esa ciencia que consiste en aprender que formamos parte de un mundo que nos pertenece a todos y no a unos cuantos..¿ves el sentido que adquiere?. verdadera religion es la que no impone reglas,si no la que enzeña a que uno se valore asi mismo y que seamos utilez a los demas. en cuanto a la ciencia, ella es la que se encarga de descubrir la realidad del universo ¿y para que se investiga? se investiga para darnos la verdadera identidad que nos pertenece, es decir quienes somos y hacia donde vamos,y cada una aunque no lo crean van por el mismo camino.

  147. Walter says:

    Hola Nestor:
    Lamento entonces mi falta de comprensión sobre lo que querías decir. Completamente de acuerdo en que no necesitamos un dios para dirigir nuestras vidas y que el mundo nos debia pertenecer a todos y no solo a unos cuantos, y agregaría que ese “todos” debía interpretarse en un sentido ecológico y con visión del futuro del planeta.
    Una diferencia fundamental con la religión es que la ciencia es un proceso naturalista y solo puede encontrar respuestas a las preguntas de las cosas que se encuentran dentro de la naturaleza. La existencia de un ser superior es una cuestión sobrenatural y por ello no entra en el campo de la ciencia. La religión es un asunto de creencias personales.
    La ciencia no da todas las respuestas pero no tenemos otra forma de conocer el mundo; el hecho de que no se conozcan muchas cosas ahora no quiere decir que no podamos conocerlas en el futuro.
    Saludos
    Walter

  148. maestro ateo says:

    para mi dios no existe
    pero existe segun la mitologia
    las otras iglesias q no sean catolicas son partes de porqeria de la ctistiandad

  149. Walter says:

    Hola David:
    El pasaje de Tácito no es considerado prueba de la historicidad de Jesús por ninguno de los estudiosos que cite anteriormente. Y para que compruebes que su autenticidad si está cuestionada, y que no se trata principalmente de quien lo dice sino de POR QUE SE DICE, aquí te paso información adicional. Esta vez es de John E. Remsberg.
    Las dudas sobre la autenticidad del pasaje de Tacito sobre Cristo se basa en:
    • No es citado por los padres de la Iglesia
    • Tertuliano estaba familiarizado con los escritos de Tácito y sus argumentaciones requerían citar el párrafo en cuestión, pero no lo hace.
    • Clemente de Alejandría hace una compilación de los escritos paganos que hablaban de Cristo y los cristianos. Tampoco menciona el párrafo de Tácito.
    • Tampoco lo menciona Orígenes en su controversia con Celso, y lo hubiera usado indudablemente de haber existido.
    • El historiador eclesiástico Eusebio, en el siglo IV, cita toda la evidencia obtenible de fuentes judías y paganas, y tampoco menciona el párrafo de Tácito.
    • No hay menciones del párrafo de Tácito en escritos anteriores al siglo XV
    • En el siglo XV solo había una copia de Los Anales de Tácito y se decía que databa del siglo VIII, 600 años después de la época de Tácito.
    • Como copia única en poder de los cristianos, insertar el párrafo era fácil y no debemos no olvidar que las falsificaciones cristianas (“interpolaciones piadosas”) comprobadas son abundantes.
    • Su crítica severa al cristianismo no prueba que no sea un fraude. De los escritores antiguos, el más deseable testigo para los cristianos era Tácito, pero la adulteración en un período tan tardío hubiera generado inmediato rechazo, a menos que lo hicieran aparecer como improbable.
    • Es admitido por escritores cristianos que los trabajos de Tácito no han sido conservados con un alto grado de fidelidad, se cree que parte de los escritos corresponde a Quintillo.
    • Las sangrientas historias sobre las orgías de Nerón están escritos al estilo de las novelas cristianas de las edades oscuras y no en el estilo de Tácito.
    • La historia que aparece en Tácito, excepto la mención a Cristo, se relata con casi las mismas palabras en los escritos de Sulpicio Severo, un cristiano del siglo V.
    Además he leído que Josefo no habla de las persecuciones de cristianos al referirse a Nerón y que Suetonio que habla de “castigo a los cristianos” no menciona el incendio de Roma.
    Saludos,
    Walter

  150. Lic. Eduardo Cruz says:

    hola David y Walter
    un cordial y caluroso
    saludo los 2
    seguimos en contacto…

  151. Walter says:

    De igual manera Edurdo.

  152. david says:

    Walter:
    Respecto al incendio de Roma, es una evidencia histórica.
    “Por cierto, parece evidente que es falsa la presunta culpabilidad de Nerón en cuanto al incendio que destruyó la ciudad. El fuego comenzó en las tiendas de los alrededores del Circo Máximo. Nerón se encontraba entonces de vacaciones en su ciudad natal Anzio; pero hubo de regresar a Roma a toda prisa. El incendio causó estragos durante una semana. Circuló el rumor de que Nerón habría tocado la lira y cantado desde la cumbre del Quirinal mientras la ciudad ardía. (Tácito, Ann. XV; Suetonio, Nerón XXXVIII; Dion Casio, R.H. LXII). El caso es que Roma debía de ser una ciudad impresionante. Miles de personas hacinadas en edificios que se derrumbaban e incendiaban cada dos por tres. Todo tipo de sectas orientales vaticinando el fin del mundo en soportales compartidos con prostitutas y vendedores de cuanta mercancía hubiera en el Imperio. La guardia pretoriana asesinando o eligiendo a los emperadores a su antojo. Los senadores más preocupados por sus propiedades que por la justicia. Un sinfín de esclavos torturados y obligados a trabajar hasta la extenuación… Y todo empapado en la sangre de miles de víctimas durante la celebración de los juegos.” http://es.wikipedia.org/wiki/Ner%C3%B3n
    En cuanto a Tácito: no soy historiador, y tampoco sé si es verdad que los apologistas cristianos no mencionan su pasaje. Tampoco me lo creo ciegamente, si hubiera creído a Gordon Stein, pensaría que la única prueba del incendio y de las persecuciones a los cristianos es la de Tácito.
    Un saludo

  153. Walter says:

    Hola David:
    Parece que descalificar a Gordon Stein se ha vuelto tu caballito de batalla y principal argumento; así que toco el tema: El texto de Tácito, la prueba en discusión, afirma que “en época de Nerón hubo un gran incendio en Roma y que ESTE ocasiono la persecución de cristianos y que ESTOS eran seguidores de Cristo y que ESTE había sido ejecutado por Pilatos.”, Gordon Stein dice que ningún otro historiador corrobora esa afirmación. Tú descubriste que mentía pues Suetonio habla de las persecuciones a los cristianos. Te pregunto: ¿Dice Suetonio que el castigo a los cristianos se debió a que Neron los acuso del incendio y que esos cristianos que castigaron eran los mismos que cristianos a que se refiere Tacito y que creían en un Cristo que fue ejecutado por Pilatos?¿Y que Suetonio corrobora el texto de Tacito? A mi me parece que no. Hablar de castigo sin referirse al incendio y demas no corrobora nada. Para mí tu error sobre Stein se debe a que quieres confirmar lo que dice Tácito ¡POR PARTES!. Algunos mencionan el castigo a los cristianos, pero NO hablan del incendio, y otros del incendio pero no lo relacionan con el castigo a los cristianos. (Otros ni siquiera mencionan los dos temas, Josefo por ejemplo, no obstante tratar sobre Nerón). Es como que los historiadores hablaran de la persecución a los terroristas de Al Qaeda sin hablar de la destrucción de las Torres Gemelas, o pasando por alto la conexión entre ambos; o ¡que no digan nada en absoluto al escribir la historia de nuestra época!
    Si quieres averiguar si los apologistas primitivos mencionan el texto de Tácito en cuestión, tienes la Internet, no necesitas ser historiador. Ten por seguro que si uno de los padres del cristianismo hizo mención al párrafo de Tácito, más de un entusiasta apologista lo habrá puesto en la red hace tiempo.
    Por lo demás, no creo que probando que Gordon Stein este equivocado ni que el incendio de Roma sea histórico, prueben que Jesús es histórico. Me parece por el contrario que con esto queda fuera Tácito como prueba, ¿tienes alguna más? Y coincido contigo en que no podemos confundir las evidencias racionales con la fe ciega.
    Un saludo
    Walter

  154. Eduardo Cruz says:

    Este es otro pequeño resumen del
    capitulo numero 5 del libro
    N. E. q. E. u. V.
    (editado en 2004)
    de Josh McDowell;
    y adaptado por: Lic. Eduardo Cruz
    capitulo titulado
    Jesús, un Hombre real en la historia
    Recientemente, en un debate auspiciado por la Asociación de Estudiantes de una universidad de¡ medio oeste, mi oponente, una candidata al congreso del Partido laboral Progresivo (marxista) de Nueva York,
    (de la cual omitiré su nombre por obvias razones de educación y ética)
    dijo a modo de introducción:
    “los historiadores en la actualidad ya han rechazado del todo la idea de que Jesús sea histórico . . .”
    Yo no podía dar crédito a mis oídos (pero di gracias de que ella lo hubiera dicho, pues los 2.500 estudiantes pudieron muy pronto darse cuenta de que la preparación histórica de ella era deficiente).
    Afortunadamente yo tenía conmigo las siguientes notas y documentación para usar en mi réplica.
    No son ciertamente los historiadores quienes propagan una teoría Cristo mítica de Jesús.
    Como muy bien lo ha dicho F.F. Bruce, profesor de crítica bíblica y de exégesis de Rylands en la Universidad de Manchester:
    “Algunos escritores pueden divertirse con la fantasía de un mito-Cristo, pero no lo hacen sobre la base de la evidencia histórica.
    La historicidad de Cristo es tan axiomática para un historiador no prejuiciado como la historicidad de Julio César.
    No son los historiadores los que propagan las teorías del mito-Cristo ” , concluye que, “ningún erudito serio se ha atrevido a postular la no historicidad de Jesús.”
    * Fuentes Cristianas para la Historicidad de Jesús
    VEINTISIETE DIFERENTES DOCUMENTOS DEL NUEVO TESTAMENTO
    John Montgomery
    (History and Christianíty, usado con permiso de InterVarsity Press, Downers Grove, lil.) pregunta:
    “¿Qué es lo que conoce entonces un historiador respecto de Jesucristo?
    lo primero y más importante que conoce es que puede confiar en que los documentos de¡ Nuevo Testamento pueden proporcionar un buen cuadro de él.
    Y sabe que este cuadro no puede ser rechazado por razonamientos, por esfuerzo mental, por presuposicionalismo filosófico, o por medio de maniobras literarias.”
    PADRES DE LA IGLESIA
    Policarpo, Eusebio, lreneo, Ignacio, Justino, Orígenes, etc.
    * Fuentes no Bíblicas para la Historicidad de Jesús.
    Cornelio Tácito (nacido en 52-54 D. C.)
    Fue un historiador romano, en el año 112 D. C., gobernador de Asia, yerno de Julio Agrícola que fue gobernador de Bretaña entre los años 80-84 D. C.
    Al escribir de¡ reinado de Nerón, Tácito alude a la muerte de Cristo y a la existencia de los cristianos en Roma.
    “Pero nada del alivio que pudiera provenir del hombre, ninguno de los dones que pudiera impartir el príncipe, ni los muchos sacrificios expiatorios que pudieran ser presentados a los dioses, podrían haber tenido valor para disculpar a Nerón de la infamia que significaba el que se le creyera ser el que había ordenado la conflagración, el incendio de Roma. Por tanto, para suprimir el rumor, él cargó falsamente a las personas comúnmente llamadas cristianos con la culpa, y los castigó con las más refinadas torturas, atrayendo sobre ellos el aborrecimiento de todos por sus iniquidades. Cristo, el fundador del nombre fue ajusticiado por Poncio Pilato, procurador de Judea en el reino de Tiberio: pero la superstición perniciosa, reprimida por un tiempo, volvió a hacer irrupción, no solamente a través de Judea, donde tuvo su origen este error, sino también por toda la ciudad de Roma.”
    Annais XV. 44
    Tácito hace una más amplia referencia al cristianismo en un fragmento de sus Historias, en relación con el incendio del templo de Jerusalén en el año 70 D. C., preservado por Sulpicio Severo (Crón. 11. 30.6.).
    * LUCIANO
    El satírico del siglo segundo, habló con desdén de Cristo y de los cristianos. El los vinculó con las sinagogas de Palestina y aludió a Cristo de este modo: “…
    el hombre que fue crucificado en Palestina por haber introducido este nuevo culto en el mundo …
    Aun más, el primer legislador que ellos tuvieron les persuadió de que todos ellos eran hermanos unos de otros, después de haber transgredido de una vez por todas negando los dioses griegos y adorando a aquel sofista crucificado y viviendo bajo sus leyes.”
    The Passing Peregruis.
    * FLAVIO JOSEFO (nacido el 37 D. C.)
    Un historiador judío, llegó a ser fariseo a la edad de 19 años; el año 66 D. C. fue comandante de las fuerzas judías en Galilea. Después de ser capturado, fue anexado al cuartel general de los romanos. Dice en una cita que ha sido objeto de mucho debate:
    “Ahora, había alrededor de este tiempo un hombre sabio, Jesús, si es que es licito llamarlo un hombre, pues era un hacedor de maravillas, un maestro tal que los hombres recibían con agrado la verdad que les enseñaba. Atrajo a sí a muchos de los judíos y de los gentiles. El era el Cristo, y cuando Pilato, a sugerencia de los principales entre nosotros, le condenó a ser crucificado, aquellos que le amaban desde un principio no le olvidaron, pues se volvió a aparecer vivo ante ellos al tercer día; exactamente como los profetas lo habían anticipado y cumpliendo otras diez mil cosas maravillosas respecto de su persona que también habían sido preanunciadas. Y la tribu de cristianos, llamados de este modo por causa de él, no ha sido extinguida hasta el presente”
    Antigüedades. XVIII.33.
    (Comienzos del segundo siglo).
    El texto arábigo de¡ pasaje es el siguiente:
    “Por este tiempo había un hombre sabio llamado Jesús. Y su conducta era buena, y era reconocido por su virtud. Y mucha gente de entre los judíos y de las demás naciones se hicieron sus discípulos. Pilato le condenó a ser crucificado y a morir. Los que habían llegado a ser sus discípulos no abandonaron su discipulado. Ellos informaron que se les apareció tres días después de su crucifixión y que estaba vivo; según esto, él era posiblemente el Mesías acerca de quien los profetas habían relatado maravillas.”
    El pasaje anterior se halla en el manuscrito árabe titulado:
    “Kitab Al-Unwan Al-Mukalial Bi-Fadail Al-Hikma Al-Mutawwaj Bi-Anwa Al-Falsafa AlManduh Bi-Haqaq Al-Marifa.”
    la traducción aproximada sería:
    “libro de Historia guiado por todas las virtudes de la sabiduría. Coronado con varias filosofías y bendecido por la verdad del conocimiento.”
    El anterior manuscrito, compuesto por el Obispo Apapius en el siglo décimo tiene una sección que comienza con:
    “Hemos hallado en muchos libros de los filósofos que ellos se refieren al día de la crucifixión de Cristo.”
    Luego presenta una lista y cita porciones de las obras antiguas.
    Algunas de las obras les son familiares a los eruditos modernos, y otras no lo son.
    También hallamos en Joséfo una referencia a Santiago el hermano de Jesús. En Antigüedades XX 9:1 describe las acciones del sumo sacerdote Ananus:
    “Pero el más joven Ananus, que como dijimos recibió el sumo sacerdocio, era de disposición atrevida y excepcionalmente osado, siguió el partido de los Saduceos, que son los más severos en el juicio entre todos los judíos, como ya lo hemos demostrado. Como Ananus fuese de tal disposición, pensó que ahora tenía una buena oportunidad, como Festo estaba ahora muerto, y Albino estaba todavía en camino; así que reunió un concilio de jueces, y trajo ante éste al hermano de Jesús el así llamado Cristo, cuyo nombre era Santiago, junto con algunos otros, y habiéndoles acusado de infractores de la ley, los entregó para que fuesen apedreados.”
    * SUETONIO (120 D. C.)
    Otro historiador romano, oficial de la corte en tiempos de Adriano, escritor de los anales de la Casa Imperial, dice: “Como los judíos estaban provocando continuos disturbios bajo la instigación de Chrestus (otra manera de deletrear Cristo), los expulsó de Roma.” Vida de Claudio 25.4
    También escribió: “El castigo ordenado por Nerón recayó sobre los cristianos, una clase de hombres entregados a una superstición nueva y perjudicial.” Vidas de los césares, 26.2
    * PLINIO SEGUNDO, PLINIO El MENOR.
    Gobernador de Bitinia en Asia Menor (112 D. C.), escribió al emperador Trajano pidiéndole consejo respecto de cómo tratar a los cristianos. Explicó que había estado matando a hombres y mujeres, niños y niñas. Eran tantos los que sufrían la muerte que él se preguntaba si debería continuar matando a todo el que se revelase como cristiano, o si debería matar solamente a algunos. Explicó que había hecho que los cristianos se inclinasen ante las estatuas de Trajano. Prosigue contando que también “los hizo maldecir a Cristo, algo a lo cual no puede inducirse a ningún verdadero cristiano.” En la misma carta prosigue contando de la gente sometida a juicio que:
    “Afirmaban, sin embargo, que toda su culpa, o error, consistía en que tenían el hábito de reunirse en cierto día fijo antes de que amaneciera, y que allí cantaban en versos alternados un himno a Cristo como a un Dios, y que se sometían a un juramento solemne, y no a hechos malvados de ninguna clase, sino mas bien a nunca cometer fraude, robo, adulterio, a nunca falsear su palabra, ni a negar algo que se les hubiera confiado cuando fueran llamados a dar cuenta de ello.”
    Epístolas X. 96
    * TERTULIANO
    Julista-teólogo de Cartago, en una defensa de¡ cristianismo (197 D. C.) ante las autoridades romanas en África, hace mención de¡ intercambio epistolar habido entre Tiberio y Poncio Pilato:
    “Según Tiberio, en aquellos días el nombre cristiano hizo su entrada en el mundo, habiendo él mismo llegado a convencerse de la verdad de la divinidad de Cristo, presentó el asunto ante el senado, con su propia decisión en favor de Cristo. El senado, por no haber él mismo dado su aprobación, rechazó la proposición de éste. César se mantuvo firme en su posición, amenazando con descargar su ira contra todos los acusadores de los cristianos.”
    (Apología, V. 2).
    Algunos historiadores dudan de la historicidad de este pasaje. También compare Justino Mártir,
    Apología, 1. 35.
    * TALO, EL HISTORIADOR SAMARITANO
    Uno de los primeros escritores gentiles que menciona a Cristo es Talo, quien escribió en el año 52 D. C. Sin embargo, sus escritos han desaparecido y tenemos conocimiento de ellos únicamente a través de fragmentos citados por otros escritores. Uno de tales escritores es Julio Africano, un escritor cristiano de alrededor de¡ año 221 D. C.
    Un pasaje muy interesante se refiere a un comentario de Talo. julio Africano escribe:
    ” ‘Talo, en el tercer libro de sus historias, explica esta oscuridad como un eclipse de sol –
    sin razón alguna, según me parece’
    (por supuesto que sin razón, pues un eclipse solar no tendría lugar durante el tiempo de la luna llena, y fue durante la luna llena pascual que murió Cristo).”
    Así, partiendo de esta referencia podemos ver que el relato de¡ evangelio acerca de la oscuridad que cayó sobre la tierra durante la crucifixión de Cristo era bien conocido y requería de una explicación natural para aquellos no-creyentes que lo presenciaron. 1/113
    * CARTA DE MARA BAR-SERAPIO
    F.F. Bruce registra que hay:”…
    en el Museo Británico un interesante manuscrito que preserva el texto de una carta escrita un tiempo después de¡ año 73 D. C., aun cuando no estamos seguros de cuanto tiempo más tarde. Esta carta fue enviada por un sirio llamado Mara Bar-Serapio a su hijo Serapio. Mara Bar-Serapio estaba en prisión en aquel tiempo, pero escribió para alentar a su hijo en la búsqueda de la sabiduría, y le señala que aquellos que persiguieron a los sabios fueron cogidos por la desventura. le muestra como ejemplos las muertes de Sócrates, Pitágoras y Cristo:
    ” ’¿Qué ventaja obtuvieron los atenienses con la muerte de Sócrates?
    Hambruna y plaga vinieron sobre ellos como juicio por su crimen.
    ¿Qué ventaja obtuvieron los hombres de Samos al quemar a Pitágoras?
    En un momento su tierra se vio cubierta de arena.
    ¿Qué ventaja obtuvieron los judíos al ejecutar a su sabio Rey Yesua?
    Fue precisamente después de eso que su reino fue abolido. Dios vengó con toda justicia a estos tres hombres sabios:
    los atenienses murieron de hambre; los de Samos fueron invadidos por el mar; los judíos, arruinados y expulsados de su tierra, viven en completa dispersión.
    Pero en lo concerniente al bien, Sócrates no murió, sino que sobrevivió en la enseñanza de Platón.
    Tampoco Pitágoras murió totalmente, sino que sobrevivió en la estatua de Hera.
    Ni tampoco el sabio Rey Yesua murió en lo que respecta a su influencia para el bien; sobrevivió en la enseñanza que él había impartido.’ ”
    * JUSTINO MARTIR
    Alrededor de¡ año 150 D. C. Justino Mártir, presentando su Defensa del cristianismo ante el Emperador Antonino Pío, le hizo mención del informe de Pilato, el que Justino suponía debía estar preservado en los archivos imperiales.
    Pero las palabras,
    “Horadaron mis manos y mis pies,”
    dice él,
    “es una descripción de los clavos que clavaron en sus manos y en sus pies sobre la cruz; y después que fue crucificado, los que le crucificaron echaron suertes sobre sus vestiduras, y las dividieron entre ellos; y puede usted informarse de que estas cosas fueron así en las ‘Actas’ que fueron levantadas en tiempos de Poncio Pilato.”
    Más tarde dice:
    “Fácilmente puede usted convencerse de que él hizo estos milagros a través de las ‘Actas’ de Poncio Pilato.”
    Apología 1.48.
    Elgin Moyer, describe a Justino como un:
    “… filósofo, mártir, apologista, nacido en Flavia Neápolis.
    Bien educado, parece haber tenido suficientes medios como para haber llevado una vida de estudio y de viajes.
    Por ser un ansioso buscador de la verdad, golpeó sucesivamente a las puertas del estoicismo, del aristotelianismo, del pitagoreanismo y del platonismo, pero aborrecía el epicureanismo.
    En los primeros días estuvo algo relacionado con los judíos, pero no se sintió interesado en su religión.
    El platonismo fue lo que más logró interesarle y pensaba que estaba a punto de alcanzar la meta de su filosofía – la visión de Dios cuando un día, durante un paseo solitario por la playa, el joven filósofo conoció a un venerable anciano cristiano de rostro agradable y de fina dignidad.
    Este humilde cristiano remeció su confianza en la sabiduría humana, y le señaló a los profetas hebreos,
    ‘hombres más antiguos que todos aquellos que eran estimados filósofos, y cuyos escritos y enseñanzas anticipaban la primer venida del Cristo sufriente a su propio pueblo y aun que fue rechazado y ejecutado por ellos,
    sin embargo hoy vive . . .’
    Siguiendo el consejo del anciano caballero, este ferviente discípulo de Platón se convirtió en un creyente cristiano.
    El declaró, ‘Hallé que sólo esta filosofía era segura y provechosa.’ Después de la conversión, que ocurrió durante los primeros años de la madurez, se dedicó totalmente a la vindicación y propagación de la religión cristiana.”
    * LOS TALMUDES JUDIOS.
    Tol’doth Yeshu. Se hace referencia a Jesús como “Ben Pandera.”
    Talmud Babilónico. (Presenta la opinión de los amoritas) dice:
    …” y lo colgaron en la víspera de la
    Pascua “…
    El Talmud se refiere a Jesús con el título de “Ben Pandera (o ‘Ben Pantera’)” y “Jesús ben Pandera.”
    Muchos eruditos dicen que “pandera” es un juego de palabras, un uso que ridiculiza la palabra griega “parthenos”, que significa virgen, llamándole así “hijo de una virgen.”
    José Klausner, un judío, dice que “el nacimiento ilegítimo de Jesús era una idea corriente entre los judíos.
    Los comentarios en la Baraila son de gran valor histórico:
    “En la víspera de la Pascua colgaron a Yeshu (de Nazaret) y el heraldo estuvo yendo delante de él durante cuarenta días diciendo que (Yeshu de Nazaret) habría de ser apedreado por haber practicado la hechicería y haber engañado y descaminado a Israel.
    Que todo el que tuviera algo que decir en su defensa acudiera para alegar en su favor.
    Pero no se encontró a nadie que lo defendiera y lo colgaron en la víspera de la Pascua” (Babilonia Sanedrín 43a). – “Víspera de la Pascua.”
    El Amoa ‘Ulla’ (‘Uila’fue un discípulo de R. Youchanan y vivió en Palestina a fines del Tercer siglo.) añade:
    “¿Y suponen ustedes que para
    Yeshu de Nazaret había algún derecho de apelación?
    Era un seductor, … pero con Yeshu fué diferente, pues estaba próximo a la autoridad civil.”
    Las autoridades judías nunca negaron que Jesús realizara señales y milagros (Mateo 9:34; 12:24; Marcos 3:22) sino que los atribuyeron a actos de brujería.
    “El Talmud,” escribe el erudito judío José Klausner,
    “habla de colgar en lugar de crucifixión, puesto que esta horrible forma romana de muerte era conocida únicamente a los eruditos judíos a través de los juicios romanos, ya que no existía en el sistema legal judío.
    Aún el mismo apóstol Pablo
    (Gálatas 3:13) interpreta el pasaje ‘porque maldito por Dios es el colgado’
    (Deut. 21:23) como aplicable a Jesús.”
    Sanhedrín 43a hace referencia también a los discípulos de Jesús. Yeb. IV 3;49a:
    “R. Simeón ben ‘Azzai dijo
    (refiriéndose a Jesús):
    ‘Hallé una lista genealógica en Jerusalén en donde estaba inscrito, el Tal es un bastardo de una adúltera.’ ”
    Klausner añade a lo anterior que:
    “las ediciones corrientes de la Mishnah agregan:
    ‘Para apoyar las palabras de R. Yehoshua’ (quien, en la misma
    Mishnah, dice: ¿Quién es un bastardo?
    Todo aquél cuyos padres están expuestos a la muerte por el Beth Din).
    Está fuera de toda duda que aquí la referencia es a Jesús.. ”
    Un temprano baraita, en el cual R. Eliezer es la figura central, habla de Jesús nombrándolo directamente.
    Los paréntesis van dentro de la cita. Eliezer habla:
    “El contestó, Akiba,
    ¡me has hecho recordar algo!
    Una vez me hallaba caminando por el mercado superior (Tosefta lee’calle’) de Séforis y hallé a uno de ellos de los discípulos de Jesús de Nazaret y a Jacobo de Kefar Sekanya (Tosefta lee ‘Sakkanin’) que era su nombre. El me dijo; Está escrito en vuestra ley, ‘No llevarás adentro el salario de una ramera, etc.’
    ¿Qué podría hacerse con él – una letrina para el sumo sacerdote?
    Pero no le contesté. El me dijo, así me enseñó Jesús de Nazaret Tosefta lee’Yeshu ben Pantera’): ‘Porque de dones de rameras los juntó, y a dones de rameras volverán; proceden del lugar de inmundicia, y al lugar de inmundicia irán. Y el dicho me agradó, y a causa de esto fui arrestado por Minuth. Y yo cometí trasgresión contra lo que está escrito en la ley; ‘Mantente alejado de aquí’ – eso es Minuth; ‘y no te acerques a la puerta de su casa’ – eso es el gobierno civil.”
    Los paréntesis anteriores se encuentran en Dikduke Sof’rim a Abada Zara (Munich Manuscript, ed. Rabinovitz).
    Klausner, al comentar el pasaje anterior dice:
    “No puede haber duda de que las palabras, ‘uno de los discípulos de Jesús de Nazaret,’ y ‘así me enseñó Jesús de Nazaret,’ son, en el pasaje en cuestión, de fecha bastante temprana y de importancia fundamental en la historia que se relata; y lo primitivo de su carácter no admite discusión sobre la base de las leves variantes en los pasajes paralelos;
    sus variantes (‘Yeshu ben Pantera’ o ‘Yeshu ben Pandera,’ en lugar de ‘Yeshu de Nazaret’) se deben meramente al hecho de que, desde una fecha temprana, el nombre ‘Pantera’, o ‘Pandera,’ llegó a ser muy corriente entre los judíos como el nombre de aquel a quien se consideraba erradamente el padre de Jesús (quien era un soldado llamado Pantera y quien supuestamente embarazó a María y no José,por que el pueblo sabia que no era hijo legitimo de José, por eso se le llamaba bastardo.”
    * ENCICLOPEDIA BRITANICA
    La más reciente edición de la Enciclopedia Británica utiliza 20.000 palabras para describir esta persona, Jesús. Su descripción requirió más espacio que el que se le concedió a Aristóteles, Cicerón, Alejandro, Julio César, Buda, Confucio, Mahoma o Napoleón Bonaparte.
    BIBLIOGRAFIA
    Bruce, F. F. The New Testament Documents: Are They Refiable?
    Quinta edición revisada. Downers Grove, ¡¡l. 60515: lnter-Varsity Press, 1972.
    Klausner, loseph. lesus of Nazareth. New York: The Macmillan Company, 1925.
    Montgomery, John Warwick. History and Christianity. Downers Grove, 111. 60515: lnter-Varsity Press, 1964.
    Moyer, Elgin. Who Was Who in Church History.
    Chicago: Moody Press, 1968.
    Pines Shlomo, profesor de filosofía en la Universidad Hebrea, Jerusalén; David Flusser, profesor en la Universidad Hebrea, comunicado de prensa de ¡ New York Times de¡ 12 de Febrero de 1972, reimpreso por “Palm Beach Post-Times,
    ” Domingo 13 de Febrero de 1972, “DOCUMENTACION ACERCA DE CRISTO: Eruditos israelitas encuentran antigua documentación que les parece confirma la existencia de Jesús.”
    Betz, Otto. What Do We Know About Jesus? SCM Press, 1968.
    pd 1
    Y en mi muy humilde y personal punto de vista (tal vez errado):
    Jesús
    -Fue
    (por las evidencias)
    -Es
    (por los testimonios actuales)
    y
    – Seguirá Siendo
    (por su impacto en la historia)
    un hombre realmente histórico…
    dividiendo en 2 la historia y cambiando millones de vidas alrededor del mundo a lo largo de 20 siglos.
    pd 2
    Fuera de todo lo sobrenatural que haya (o no) podido ser el Jesús histórico,
    no podemos descartar y negar su historicidad tan a la ligera, talvez me pudiesen discutir su deidad pero nunca su historicidad verdadera.
    pd 3
    le quitaré lo de Lic. a mi firma personal, pues en algunos foros ateos esto les molesta, no importa soy el mismo…
    pd 4
    No envio este resumen para ganar discusiones…
    sino para mostrar evidencias.
    gracias y un saludo…
    Atte: Eduardo Cruz

  155. david says:

    Hola Walter:
    He llegado a la conclusión, de que tienes hasta cierto punto razón.
    No hay pruebas sobre la existencia del Cristo mítico, aunque sigo creyendo que el mito partió de una persona que se llamó Jesús y que murió crucificada.
    Estoy de acuerdo contigo.
    Un saludo

  156. Walter says:

    Hola David:
    Si apareciera alguna prueba irrefutable de la historicidad de Jesús no tendría ningún problema en aceptarlo. Durante gran parte de mi vida creí también que era incuestionable la realidad histórica de Jesús pero cuando revise las pruebas me di con la gran sorpresa de que lo que me habían enseñado mis padres, mis maestros, lo que decían los medios de comunicación, los políticos, y hasta muchos libros y Enciclopedias, solo se basaba en la tradición.
    Te felicito por tu sinceridad y valentía, estás dando un ejemplo de integridad intelectual. Acepta por favor mis disculpas por los exabruptos que no he podido controlar en el calor del debate, y te agradezco mucho por la motivación que me diste para leer y aprender algo más.
    Un abrazo y quedamos en contacto,
    Walter

  157. Walter says:

    Hola Eduardo:
    Las “Nuevas Evidencias” de McDowell que presentas no son nuevas, son las mismas que presentaste antes y fueron refutadas, por favor, leer mensaje de David el 11 Marzo 2006 y otros pues el tema se han tratado abundantemente. También hallarás referencias de historiadores que SI discuten la existencia de Jesús. Si consideras que hay algo nuevo te agradecería mucho que lo especifiques.
    La afirmación de que la historicidad de Jesús es igual a la de Julio Cesar te la refuto con un solo ejemplo: Julio Cesar escribió “La Guerra de las Galias” y Jesús no escribió nada. También citas un libro llamada “27 documentos” pero no dices que documentos son ni como prueban que Jesús es histórico, si deseas me los detallas, pero recuerda que no discutimos la mitología evangélica sino la historia secular.. Los padres de la Iglesia que mencionas no vivieron en épocas de Jesús para dar fe de su existencia histórica y sólo se basan en las tradiciones cristianas.
    En cuanto a las pruebas no cristianas, se ha repetido tanto que te puedo hacer un resumen de memoria: Primero te hago recordar que “Cristo” no es un nombre es un titulo que siginifica “Elegido” y que haba montones de Cristos por la época. Tácito tiene un breve párrafo cuya autenticidad es dudosa y aun siendo verdadero solo repite lo que decían los cristianos de su dios, no relata ningún hecho histórico de la vida de Jesús.. Luciano escribe en el siglo II y su referencia se basa igualmente en lo que los cristianos creían y no en fuentes históricas. La cita de Josefo es un fraude y solo prueba que la adulteración de documentos era una práctica común entre los padres del cristianismo. Suetonio habla de un tal Cresto que causaba disturbios en Roma y no de un tal Cristo muerto un siglo antes. Plinio el Joven solo hace referencia a lo que los cristianos adoraban y cantaban, no es prueba histórica de Jesús. Tertuliano es muy tardío y la carta es una falsificación comprobada; dicho sea de paso Tertuliano, igual que Origenes y otros escritores cristiano anteriores al siglo IV citan extensamente a Tácito y a Josefo, pero NO menciona para nada los pasajes sobre Cristo y los cristianos que pones como supuestas pruebas de la historicidad de Jesús, demostrandose una vez mas que son inserciones fraudulentas posteriores. En el caso de Talos, no hay ninguna evidencia que hubiera un eclipse en la época de la supuesta crucifixión de Jesús, y es una referencia de tercera mano que tampoco prueba que Jesús existiera. La carta de Bar Serapion no se sabe de qué año es y no menciona a Jesús ni a Cristo. Justino Mártir se basa en un reporte inexistente de Pilatos a Tiberio. Los talmudes judíos se escribieron a partir del siglo II y la referencia a Yeshu se refiere a un personaje de 100 años antes del supuesto tiempo de Jesús. El que la Enciclopedia Británica hable de Jesús no prueba que sea histórico, esa deducción una falacia lógica conocida como “Non Sequitur”, La Enciclopedia también habla de Hércules pero eso no prueba que sea un personaje histórico.
    Tus postdatas son afirmaciones sin sustento y no prueban que Jesús existiera: “No fue” pues no hay evidencias, “no es” pues los testimonios son producto del dogmatismo de tu fe y no evidencias históricas, el “seguirá siendo”, es una propaganda religiosa que nada tiene que ver con la historia. Tampoco se trata de negar o descartar la historicidad de Jesús, se trata de buscar la verdad y la validez de las pruebas que presentan los creyentes. Si analizas a fondo veras que no hay pruebas históricas irrefutables y que McDowell miente.
    Walter

  158. Walter says:

    Post data para Eduardo:
    Y para que no creas que pretendo insultar a McDowell llamandolo mentiroso, aclaro que me refiero a la falsedad de las pruebas que presenta y no a su persona en general.
    Lamentablemente el dogmatismo lleva muchas veces a justificar la mentira como defensa de la fe. El fundador del protestantismo Martin Lutero (y antes que el incluso los padres de la iglesia, como Eusebio de Cesarea) escribian abiertamente condonando la mentira en defensa de la fe. Cito:
    “¿Qué daño se haría si un hombre dijera una buena y gran mentira por el bien de lo bueno y de la iglesia cristiana, una mentira por necesidad, una mentira útil? Tales mentiras no irían en contra de Dios; Él las aceptaría” [ Martín Lutero]
    Walter

  159. Walter says:

    Eduardo:
    Le di una revisada al tema de Thalos, que era el que menos conocía, y comprendí que no estaba familiarizado pues casi nadie lo usa como prueba de la historicidad de Jesús por ser un argumento falaz e irracional:
    Los Evangelios dicen que a la hora sexta (al mediodía) cuando crucificaron a Jesús se oscureció el cielo durante 3 horas. McDowell pretende probar que un supuesto eclipse mencionado por Thalos y supuestamente citado por Julio Africano en el siglo III, explica la oscuridad y prueba la historicidad de Jesús. Pero el propio McDowell anula su evidencia al reconocer que se trata de un imposible eclipse solar, debido a que la Pascua judía se celebra en época de luna llena y es físicamente imposible que haya eclipses en esa época; también es físicamente imposible que un eclipse dure 3 horas, o que cubra toda la tierra. Algunos apologistas, para encubrir esta irracionalidad, llegan al extremo de pasar la hora sexta, de la crucifixión, para la noche y cambian el eclipse de sol por eclipse de luna, pero no explican porqué se habla de una súbita y dramática oscuridad, si ya era de noche.
    Un evento tan singular como un eclipse y un terremoto simultáneos no podría haber pasado desapercibido para los historiadores de la época, pero nadie lo registra.
    Evangelios discrepantes
    1.- Mateo habla de oscuridad, de terremoto y de muertos que se levantan de su tumba (zombis) y que recorren Jerusalén asustando a los pobladores.
    2.- Marco y Lucas solo mencionan la oscuridad, pero no el terremoto, ni los zombis.
    3.- Juan no habla ni de la oscuridad, ni del terremoto, ni de los zombis.
    También, observé que los evangelios dicen la hora y el día de la crucifixión pero ¡no se sabe de que año!. Busque en diferentes sitios; unos dicen “el año 33″, otros “el año 29″ y otros simplemente “del 28 al 36″.
    Walter

  160. Lic Eduardo Cruz says:

    Sobre lo de las posdatas…
    Creo que si aclaré que era mi muy personal (y humilde) punto de vista
    y puede llamarlo como quiera
    Estoy de acuerdo con usted en algunas cosas como que yo también
    Soy anti dogmatismos,
    anti tradiciones
    y anti religión
    (y en esta ocasión no me refiero a Roma exclusivamente si no a cualquiera y espero que no ofenda a algun religioso mi comentario)
    Entre los muchos daños irreversibles que ha producido la religión
    (en el concepto general de la palabra)
    es la imposición de el poder y la autoridad errada y que ha vacunado a la humanidad en contra de la verdad.
    Aquí en México decimos que
    tratan de dar a la gente
    atole con el dedo
    basándose en tradiciones, costumbrismos, dogmatismos
    ect..
    (recordemos que Jesus mismo costantemente confrontaba a los religiosos de su tiempo)
    Tampoco voy a defender a Lutero.
    ni a Mc Dowell.
    Con respecto a lo de
    Cristo
    hace años ( y aun antes de ser creyente que ya sabia que ese es un titulo y no un nombre personal y quiero aclarar (sin afán de ofender) que proviene del Griego y no significa Elegido
    si no Ungido y tiene la misma raíz
    de la palabra hebrea Mesías
    aunque ciertamente se ha atribuido al Jesús histórico.
    También es cierto que había algunos que se creían mesías en ese
    tiempo-espacio
    (incluso dentro de la Biblia, Lucas habla de algunos de ellos en su segundo tratado)
    Tengo más respuestas, y espero que
    sigamos en contacto mientras el tiempo así lo permita.
    Saludos cordiales a los dos
    (David y Walter) cuidense
    Atte Eduardo Cruz.

  161. Walter says:

    Hola Eduardo:
    Estoy de acuerdo en que es nefasto el dogmatismo porque limita nuestra capacidad para razonar libremente.
    Pero no me definiría como anti-religioso, pues respeto la libertad religiosa (que incluye mi derecho a no creer y a refutar); ni tampoco me siento anti-tradicionalista pues considero que las tradiciones son parte de nuestro bagaje cultural. Solo hay que evitar confundir el mito con la realidad.
    Sobre la palabra “Cristo”, es cieto que significa “Mesías” y que este término significa “UNGIDO” pero uso su sentido de “Elegido” para que no se confunda con “UNTADO”.
    Aprovecho que toques el tema para transcribirte algo sobre otros Mesías:
    “Los escritores del Talmud [4os 5os siglos DC] lo confundieron con dos hombres diferentes ninguno de los cuales puede haber sido el Jesucristo de los Evangelios.
    Uno de estos, Jesús Ben Pandira, reputado como un hacedor de maravillas, se dice, que fue apedreado a muerte y luego colgado de un árbol en vísperas de una Pascua de los judíos en el reinado de Alexander Janaeus (106-79 AC) en Jerusalén.
    El otro, Jesús Ben Stada, cuya fecha es incierta, pero que podría haber vivido en el primer tercio del segundo siglo EC, fue apedreado y ahorcado en vísperas de una Pascua de
    los judíos, pero en Lydda, (no en Jerusalen).” Gordon Ryland ¿Jesús Alguna vez Vivió?
    Saludos,
    Walter

  162. david says:

    Hola Eduardo:
    Acerca de las referencias de Jesús en el Talmud:
    Primero debemos explicar que el Talmud actual virtualmente no contiene mención de Jesús. Esto es porque había mucha persecución a los judíos durante la Edad Media, y muchos judíos estaban temerosos de que la presencia de las numerosas referencias desfavorables a Jesús que existían en el Talmud de la época hubieran engendrado ira adicional en los cristianos. Se acordó en que estas referencias fueran gradualmente eliminadas durante las múltiples copias subsecuentes de este texto. Sin embargo, la mayoría de estas referencias a Jesús no se han perdido porque han sido recolectadas por académicos de copias antiguas del Talmud y han sido vueltas a publicar muchas veces.
    Si miramos los textos que han sido removidos de las copias más tardías del Talmud concernientes a Jesús, podemos ver que dicen que él era un bastardo y un mago que aprendió conjuros mágicos en Egipto o que robó del templo el nombre sagrado de Dios y lo usó para hacer magia o milagros. También se afirma que el padre de Jesús era un soldado llamado Pantera.
    De todas formas, las autoridades han concordado en que la mayoría de este material talmúdico se deriva del período que va del 200 al 500 A.D., y que representa intentos Judíos para tratar con la creciente fortaleza del cristianismo. Por lo tanto, no es una verificación independiente de la existencia de Jesús, porque la intención era la de enfrentarse a la ideología cristiana.
    Esto a su vez, determina que su intención no fue la de ser históricamente preciso, y de hecho, no es útil de ninguna forma para determinar si Jesús fue un personaje histórico.
    Esto significa que el escriba Talmúdico estaba simplemente reportando lo que había sido dicho por los cristianos (y esto, cerca del 300 AD.). El pasaje describe cómo Jesús fue apedreado y colgado por practicar magia. Eso no suena muy parecido a los relatos del Nuevo Testamento.
    Un saludo

  163. Junjan says:

    Probando los comentarios tras una pequeña actualización…

  164. Lic. Eduardo Cruz says:

    Un saludo cordial para usted
    Junjan o Eusebio o moderador
    (o como quiera que se llame)
    Gracias por dejarnos seguir escribiendo y comentando en
    la opinión alternativa
    y aunque es algo tarde
    desde mi primer comentario,
    tal vez debí comenzar diciéndole
    que el tema con el que usted abrió
    este foro habla de una
    radical postura del
    fanatismo religioso
    que hasta puede llegar a dar
    asco a los que leemos la noticia
    (así como a estos 2 o 3 individuos les pudo haber producido nauseas tan solo el titulo de la obra teatral)
    …y aun que nunca estaré de acuerdo en lo que estos hombres hicieron,
    así tampoco apoyaría la postura y el titulo de la obra de ninguna manera.
    Creo que Dios no necesita
    que nadie lo defienda,
    Él lo puede hacer Solo.
    atte. Eduardo Cruz

  165. Martha says:

    Lo que no es entendible de esto es la evidente parcialidad y el asombro del ataque de que fue objeto la “obra” con su “elocuente” título. Si el ser humano es inteligente y por lo mismo previsivo, si voy a hacer tan olámpicamente algo así, debo tomar en cuenta que existen seres humanos alrededor que creen en Dios, entonces como consecuencia alguna reacción debe tener tamaña “elocuencia”. No se puede hablar de derechos cuando se los falta , así de simple, hay que aplicar la “Regla de Oro”: “Haz con otros como quieres que se haga contigo”. Esto es un ejemplo vivo de la ley de la siembra y la cosecha, toda acción genera una reacción. Pensar antes de actuar, OK?

  166. P-LO says:

    LIC. EDUARDO CRUZ…
    El demostrar bajo evidencia que Jesús resucito me parece extraordinario, te has metido en serios problemas y eso es digno de admirar… Hablar de Dios hasta cierto punto es aceptable, pero hablar de Jesús es meter el dedo en la llaga de aquellos confundidos que no pueden explicarse a si mismos de donde vienen y a donde van.
    Que horrible vivir en la contradiccion de su vida, tratando de refutar una verdad inegable, que JESUS ES EL SEÑOR…
    si alguien no quiere creer en Dios, porqué vive la vida que SOLO EL LE DIO? Lo peor de ser malagradecido es no darse cuenta de eso: de la ingratitud del corazón endurecido que rechaza a JESUS, para ser su propio dios, que vida tan miserable y egoista. Puedes decir que conoces la felicidad o la plenutid sin Dios?, si las 2 estan ligadas a CONOCERLE Y VIVIRLE. sinceramente perla lopez…
    PD. Gracias JESUS por sacarme de la ignorancia, porque al conocerte todo fue esclarecido, se perfectamente de donde vengo y a donde voy…

  167. Walter says:

    “El escritor Pío Baroja publicó un relato del momento en que, debido a sus ideas, estuvo a punto de ser fusilado por los requetés (fundamentalistas cristianos franquistas) en el pueblo de Santesteban: _”…El pueblo tiene un camino que pasa por un puente para unirse a la carretera. En esa encrucijada se aglomeraban los requetés y el público. Entonces el hombre alto que me había amenazado con una pistola se acercó a nuestro coche, y dijo, señalándome y mostrándome a los requetés:_
    _-Este es el viejo miserable que ha insultado en sus libros a la religión y al tradicionalismo.”_
    Lo que llaman insultos a Dios son apreciaciones dogmáticas. Dios no existe, no se puede insultar algo inexistente.
    En cuanto a que ofendan a sus creencias, están en todo su derecho de responder con las mismas armas, es decir, teatro con teatro, palabras con palabras,ideas con ideas, ironia con ironía, burla con burla.
    Parece que algunos pretenden justificar que se responda con bombas, balas y agresiones físicas a las IDEAS QUE NO SON CAPACES DE REFUTAR O RESPONDER. Solo en un cerebro atrofiado por el fanatismo religioso puede pensarse que es una “regla de oro” decir “SI INSULTAS A MI DIOS YO TE MATO”

  168. Walter says:

    No todos creen en Jesus ni en el Dios cristiano, y no por ello tienen que ser malas personas o tener vidas desastrosas.
    Hay muchos que no creen en dios y se guian por las siguientes pautas:
    * Una convicción de que los dogmas, ideologías y tradiciones religiosas, sociales o políticas, deben ser avalados y probados por cada persona de manera individual en lugar de ser aceptados simplemente por cuestión de fe.
    * El compromiso con el uso de la razón crítica, la evidencia factual y el método científico, en lugar de la fe y el misticismo, en la búsqueda de soluciones para los problemas de los humanos y las respuestas para las cuestiones humanas más importantes.
    * Una preocupación primaria con la satisfacción, el desarrollo y la creatividad tanto para el individuo como para la humanidad en general.
    * Una búsqueda constante por la verdad objetiva, teniendo entendido que nuestra imperfecta percepción de esa verdad es constantemente alterada por nuevos conocimientos y experiencias. (N. del T. En realidad los Humanistas Seculares reconocen que “conocer la verdad objetiva” es en si utópico. Sin embargo, es posible realizar una considerable aproximación al conocimiento objetivo, aunque sabemos que éste nunca podrá ser plenamente alcanzado.)
    * Una preocupación con esta vida y un compromiso de dotarla de sentido a través de un mejor conocimiento de nosotros mismos, nuestra historia, nuestras conquistas intelectuales y artísticas, y las perspectivas de aquellas que difieren de nosotros.
    * Una búsqueda de principios viables de conducta ética (tanto individuales, como sociales y políticos), juzgándolos por su capacidad de mejorar el bienestar humano y la responsabilidad individual.
    * Una convicción de que con la razón, un mercado abierto de ideas, buena voluntad y tolerancia, se puede obtener el progreso en la construcción de un mundo mejor para nosotros y nuestros hijos.
    http://www.sindioses.org/sociedad/HumSec.html

  169. Walter says:

    PD: Concepto basico que añadir es: “Las leyes físicas del universo no están subordinadas a entidades inmateriales o sobrenaturales como demonios, dioses u otros seres “sobrenaturales” fuera del dominio del universo natural.”

  170. Eduardo Cruz says:

    Las piedras claman:
    evidencia de la arqueología.
    La arqueología, ha brindado una gran confirmación en cuanto a la certeza de la Biblia.
    Nelson Glueck ,el renombrado arqueólogo judío escribió:
    “Se puede afirmar categóricamente que ningún descubrimiento arqueológico a cuestionado jamás una referencia bíblica,
    pues la increíble certeza en la memoria histórica de la Biblia…
    (la cual es particularmente así cuando)
    …es fortificada por el dato arqueológico.”
    W. F. Albright agrega:
    “El excesivo escepticismo que se mostró hacia la Biblia por algunas escuelas históricas importantes de los siglos 18 y 19…
    (y que de pronto quiere urdidamente resucitar )
    …ha sido progresivamente desacreditado.
    Un descubrimiento tras otro ha establecido la certeza de muchísimos detalles y ha traído (como consecuencia) un reconocimiento creciente en cuanto al valor de la Biblia
    como una fuente de autoridad historica.
    Los descubrimientos arqueológicos de la ultima generación en Egipto, Siria y Palestina han llegado a establecer la singularidad del cristianismo primitivo como un fenómeno histórico.
    Y (en mi opinión personal)
    a medida que el estudio critico de la Biblia sea mas y mas influenciado por el material del antiguo medio oriente, creo que veremos un constante aumento en el respeto hacia la Biblia como documento histórico, pues contiene pasajes y detalles hasta ahora pasados por alto o despreciados sobre el Antiguo y Nuevo Testamento.”
    Burrows menciona que:
    “El escepticismo excesivo de muchos (ateos, incrédulos o escépticos modernos) no surge de una evaluación cuidadosa de los datos disponibles
    ( a priori ),
    si no mas bien de una predisposición enorme de en contra de lo sobrenatural…
    (o lo que aparentemente no tiene una explicación racional,
    lógica o inmediata.)
    Sin embargo, el trabajo arqueológico
    incuestionablemente ha fortalecido la confianza en la veracidad del registro bíblico.
    Hay mas de un arqueólogo, que (después de sus propias experiencias en excavación dentro de Palestina),
    hayan aumentado su respeto hacia la Biblia.
    En general, la evidencia que nos ha brindado la arqueología hasta ahora, …
    (en especial al darnos manuscritos adicionales y mas antiguos que los mismos libros de la Biblia)
    …fortalecen nuestra confianza en la seguridad con la cual se ha transmitido texto a texto…
    (dentro de sus pulcras y escrupulosas transcripciones)
    …los libros de la Biblia a través de los siglos.”
    atte Eduardo Cruz

  171. Eduardo Cruz says:

    LA INCREÍBLE PRECISIÓN DEL MEDICO LUCAS COMO HISTORIADOR.
    La confiabilidad de Lucas como un historiador es incuestionable.
    Las sombras de algunos pasajes que parecían de dudosa confiabilidad para algunos arqueólogos que prematuramente habían desacreditado la veracidad …
    ( de los relatos de Lucas sobre personajes, eventos enteros de cierta historicidad importante como censos, disturbios, asambleas así como también fechas y ciudades
    “perdidas” del siglo 1 ).
    … han ido poco a poco desapareciendo,
    con los recientes y asombrosos descubrimientos del siglo pasado por las autoridades imparciales y los eruditos mas escépticos del ramo de la arqueología contemporánea.
    * Unger nos dice que
    “ La arqueología ha autenticado los relatos de los evangelios especialmente los de Lucas. En los círculos de erudición hay ahora acuerdo en que el libro de los Hechos de los Apóstoles es la obra de Lucas que pertenece al siglo 1 y que involucra las labores de un historiador cuidadoso que estaba sustancialmente seguro del uso de sus fuentes. confiables de documentación”…
    * Después de 30 anos de estudios Sir William Ramsay
    (considerado uno de los más grandes arqueólogos que han existido) comenta que:
    “ Lucas es un historiador de primer nivel, sus declaraciones…
    … son de hecho dignas de confianza…
    (en cuanto a geografía se refiere por ejemplo,
    ubicándonos en tiempo y espacio reales de su contemporaneidad)
    por que fue muy detallista en su narración demostrando una veracidad maravillosa…
    … este autor debe de estar ubicado junto a los mas grandes de los historiadores, pues la historia de Lucas no puede ser superada en cuanto a su confiabilidad.”
    * El historiador romano A. N. Sherwin White nos comenta sobre Lucas que
    “ La confirmación de la historicidad del libro de los hechos de los apóstoles
    (o su segundo tratado, ambos el 1 y 2 dedicados a un tal Teofilo amigo suyo)
    es abrumadora …
    … cualquier intento de rechazar su historicidad básica debe ahora parecer como absurda.
    Los historiadores romanos la han dado por sentada desde hace mucho tiempo.”
    * Geisler lo resume así
    “ En total Lucas tan solo nos menciona…
    32 países,
    54 ciudades y
    9 islas
    … sin el mas mínimo margen de error ”
    * E. M. Blaikloch concluye diciéndonos que
    “ Lucas es un historiador consumado y por derecho propio podria ser ubicado entre los grandes historiadores y escritores griegos del primer siglo.”
    atte Eduardo Cruz

  172. Eduardo Cruz says:

    El derecho de replica de
    LOS TESTIGOS OCULARES
    y los escritores del Nuevo Testamento
    * PEDRO
    Porque no les hemos dado a conocer el poder y la
    (primer)
    venida de nuestro Señor Jesucristo,
    SIGUIENDO FABULAS ARTIFICIOSAS,
    (o inventándolas)
    si no que…
    (ciertamente)
    habiendo visto con nuestros propios ojos SU MAJESTAD.
    (siendo pues testigos oculares y presénciales de estas cosas)
    * También el medico LUCAS
    (compañero de viaje de Saulo de Tarso)
    testifica acertadamente en su evangelio (o su primer tratado)
    * LUCAS cap 1. – vers.1 al 4 dice:
    1
    Puesto que ya muchos han tratado de en ORDEN LA HISTORIA
    de las cosas que entre nosotros
    HAN SIDO CIERTÍSIMAS
    2
    tal como nos lo enseñaron
    (y como nos lo han corroborado)
    los que desde el principio
    LO VIERON CON SUS PROPIOS OJOS
    (puesto que son testigos oculares)
    y fueron ministros
    (servidores y proclamadores)
    de la palabra;
    3
    me ha parecido también a mi,
    (Lucas)
    DESPUÉS DE HABER INVESTIGADO CON DILIGENCIA TODAS LAS COSAS DESDE SU ORIGEN,
    escribírtelas por orden oh excelentísimo Teofilo
    4
    para que conozcas bien la verdad de las cosas en las cuales has sido instruido.
    Comentario:
    Muchos ya habían tratado de organizar de una manera ordenada las colecciones de fragmentos de las enseñanzas y de la obra del Jesús historico y los testigos presenciales (oculares) habían preservado y narrado lo que habían visto y oído.
    Lucas no estaba interesado en escribir teoría religiosa o teología si no mas bien si no que el hace una narrativa de las cosas que diligentemente investigó y para él han sido ciertísimas
    la expresión
    “después de haber investigado con (toda) diligencia“
    traduce el interés de Lucas por mantenerse apegado a los hechos como historiador.
    La expresión de:
    “escribírtelas por orden“
    se refiere a organizar los acontecimientos por orden cronológico y de importancia.
    “Oh excelentísimo Teófilo“
    Habla de un titulo honorífico de respeto pues era una persona de alto rango quien posiblemente haya sido su maestro a quién por cierto le dedica su segundo tratado, esto quiere decir el libro de los Hechos de los apóstoles.
    Lucas deseaba establecer la autenticidad y confiabilidad del mensaje cristiano basándose cuidadosamente en hechos, lugares y personajes reales e históricos.
    Por ejemplo:
    * Herodes “El Grande“
    (reino en Judea durante los años 37 a.C. al 7 d. C.)
    se le menciona durante el relato del nacimiento de Jesús en Lucas 1.5
    * Herodes Antipas ( el tetrarca ) tenia a su cargo una jurisdicción y participo (junto con Poncio Pilato) en el juicio del Jesús histórico
    Lucas 9.7 al 9
    Lucas 23. 6 al 12
    * Herodes Agripa 1
    ( reinó del 37 al 44 d. C.)
    hechos 12. 1
    Fue nieto de Herodes “El Grande“, y poco se sabe de este hombre pero en la Biblia se le menciona en el libro de los hechos de los apóstoles y también se sabe que ayudo a Claudio a convertirse en Emperador de Roma, después que el famoso Calígula
    (Italia, 12 d.C. -Roma, 41 d.C.)
    fuera asesinado.
    En el libro de los Hechos de los apóstoles en el capitulo 12. versos del 20 al 24, se registra la versión que da Lucas sobre la insólita muerte de este Herodes y mas adelante también fue corroborada por Joséfo, historiador Judío del siglo 1
    Al incluir este relato Lucas trata de indicar una conexión entre la muerte de Herodes y una de las primeras persecuciones de los cristianos del primer siglo después también llamados hugonotes.
    Lucas establece meticulosamente las circunstancias que rodearon el nacimiento del Jesús histórico, relacionándolo con acontecimientos relacionados con el Imperio Romano.
    * Augusto César
    Fue emperador desde el año 30 a. C. hasta el 14 d. C.
    Lucas 2.1
    * Cirineo
    Lucas 2.2
    Era gobernador de Siria entre los años 10 y 7 A. C.
    Y en una segunda ocasión en los años 6 al 9 D. C.
    Fue cuando se realizo el famoso censo del que hablan los arqueólogos durante el nacimiento del Jesús histórico
    (que por cierto que el censo tenia que ver con los impuestos)
    El nacimiento de Jesús se efectuó unos años antes del año 1 de nuestra era.
    La discrepancia en las fechas se debe a un calculo equivocado al intentar establecer el calendario cristiano en el siglo 4
    Este error no debe ser atribuido a la Biblia ni a los escritores contemporáneos del Nuevo testamento
    * HECHOS cap. 1 vers, 1 y 3 dice:
    1
    En el primer tratado OH Teófilo, hablé
    (testifique escribiendo de mi puño y letra)
    acerca de todas las cosas que Jesús comenzó a hacer y a enseñar…
    3
    …a quienes
    (…refiriéndose a los apóstoles que Cristo mismo había escogido…)
    también DESPUÉS DE HABER PADECIDO, SE PRESENTÓ VIVO CON MUCHÍSIMAS PRUEBAS INDUBITABLES, APARECIÉNDOSELES DURANTE 40 DÍAS Y HABLÁNDOLES acerca del reino de Dios.
    Cometarios:
    “En el primer tratado“
    habla de el evangelio de Lucas
    esta palabra INDUBITABLES
    que usó Lucas en la introducción y dedicación de su relato escrito en el libro de los Hechos de los Apóstoles, es una de las palabras mas fuertes que usan algunos abogados para reafirmar hechos que ellos mismos presenciaron o podían corroborar con pruebas sustentadas por evidencia bibliografiíta de primera mano.
    atte Eduardo Cruz

  173. Walter says:

    Hola Eduardo:
    Evidencia arqueológica bíblica ¿CUAL?
    Muy interesantes las opiniones de los arqueólogos que citas. ¿Serías tan amable de indicar cuales son las pruebas arqueológicas a que se refieren?
    Walter

  174. Eduardo Cruz says:

    Con mucho gusto Walter
    pero primero le envío un saludo cordial de nuevo.
    Solo le pido un poquito de paciencia…
    … porque tengo ya a la mano mas información bibliografica fidedigna, pero usted debe de comprender que
    el tratar de resumir tanta información se lleva su tiempo.
    Gracias a Dios que tengo vacaciones y un poco mas de margen para escribir estos comentarios.
    cuídese mucho.
    Saludos también a David
    a Martha
    y a P-LO (Perla López)
    atte. Eduardo Cruz.

  175. Walter says:

    Eduardo:
    En cuanto a las “pruebas de testigos oculares” sobre la calidad de historiador de Lucas, estás citando a los personajes de la propia obra de ficción de “Lucas et al”, que son los Evangelios, como prueba de su propia historicidad. Hay una referencia circular en tu lógica: “Lucas en un gran historiador pues Pedro da fe de Lucas” y ¿Cómo sabes que Pedro existió para dar fe de Lucas?: “Pedro existe porque lo dice Lucas.”
    Lo que dicen los padres del cristianismo en los siglos siguientes son mitos fundacionales, no realidad histórica.
    Parece que afirmas también que Lucas es un gran historiador, que los evangelios son verdaderos y que Jesús existió PORQUE los Evangelios mencionan a los HERODES, es decir “si los Herodes existieron entonces todo el resto es cierto, Lucas es un gran historiador y Jesus también existió”. Dostoyevsky, en su novela “Crimen y Castigo” menciona al Zar Nicolás y a la ciudad de San Petesburgo, entre muchos otros aspectos de la vida de la Rusia de su tiempo. Con la ilógica que usan los apologistas podemos deducir que “Dostoyevsky es un gran historiador, Crimen y Castigo es un libro de historia, que Rashkolnikov fue una persona de carne y hueso y que todo lo que cuenta el libro es verdad histórica”.
    Si la lista que pasas son las “Nuevas Evidencias de McDowell”, sigo sin entender qué es lo que hay de NUEVO. Te pido, por favor que me expliques QUE ES LO NUEVO QUE APORTA MCDOWELL PARA PROBAR LA HISTORICIDAD DE JESUCRISTO. Hasta ahora solo has enviados opiniones de apologistas cristianos y versículos de los Evangelios. Espero EVIDENCIAS, no opiniones, ni frases célebres, ni versículos bíblicos. Sigo esperando PRUEBAS, my friend.
    Walter

  176. Martha says:

    Pobrecito Waltercito, el único con cerebro atrofiado (utilizando tus propias palabras) eres tú, no sabes ni leer peor interpretar, es propio de las mentes obnubiladas por el fanatismo y el estereotipo. Odias tanto a Dios y sus seguidores que tienes la mente estancada y llena de veneno, lo sacas y lo estampas aquí, es lo único que sabes hacer bien. Pobrecito. Sin embargo Dios tendrá misericordia de tí, un día… porque eres pobrecito.

  177. Eduardo Cruz says:

    Por eso inicie diciendo
    que era el derecho de replica
    de los testigos oculares
    ( hasta en un juicio, que no es el caso, los testigos oculares tienen su derecho de replica ¿o no? )
    No me baso en algo circular
    sino algo evidencial.
    Ya sabia y me imaginaba al menos que usted me comentaría algo de esto.
    aclaración:
    No es Pedro el que menciona la historicidad de Lucas sino al revés,
    es el Lucas histórico (del que hablan las autoridades de la arqueología)
    el que habla del famoso Pedrito y del Jesús Histórico.
    atte. Eduardo Cruz

  178. Walter says:

    PD Eduardo: Salud también para ti y que disfrutes tus vacaciones.

  179. Eduardo Cruz says:

    Muchas gracias e igualmente para usted Walter
    Y OTRA VEZ VUELVO A CITAR A
    Burrows:
    “El escepticismo excesivo de muchos
    (ateos, incrédulos o escépticos modernos)
    no surge de una VERDADERA evaluación cuidadosa de los datos disponibles…
    ( a priori ),
    …si no mas bien de una
    PREDISPOCICION
    enorme de en contra de lo sobrenatural…
    (o lo que aparentemente
    no tiene una explicación
    racional, lógica o inmediata.)
    Sin embargo, el trabajo arqueológico
    incuestionablemente ha fortalecido la confianza en la veracidad del registro bíblico.
    Hay mas de un arqueólogo, que
    (después de sus propias experiencias en excavación dentro de Palestina),
    hayan aumentado su RESPETO hacia la Biblia.
    En general, la evidencia que nos ha brindado la arqueología hasta ahora, …
    (en especial al darnos manuscritos adicionales y mas antiguos que los mismos libros de la Biblia)
    …fortalecen nuestra confianza en la seguridad con la cual se ha transmitido texto a texto…
    (dentro de sus pulcras y escrupulosas transcripciones)
    …los libros de la Biblia a través de los siglos.”
    P. D. 1
    Seria muy riesgoso tratar de afirmar algo sin pruebas por lo tanto la lógica de los apologistas no esta basada en que
    “podemos deducir”
    y empezar a hacer especulaciones prematuras u osadas afirmaciones fundadas en fábulas artificiosas
    tratando de mencionar ciudades eventos lugares y personajes reales
    (como ciertamente lo hizo Lucas)
    pero combinándolo con “un poco de misticismo religioso”
    para lograr confundir con
    digamos un 90 por ciento de verdad
    y el resto o sea el 10 que falte
    inundarlo de
    “mi ideología personal religiosa”
    (que creame… no la tengo pero para nada)
    para tratar de engañar con falacias y conseguir mas adeptos
    CREAME QUE NO ES EL CASO SEÑOR
    P. D. 2
    No solo me estoy basando en
    Mc Dowell
    (y vuelvo a aclarar que no estoy tratando de defenderle)
    luego le paso la lista de la bibliografía a la que he recurrido…
    P. D. 3
    Por cierto ya estoy terminando de traducir a sus refutadores y en ninguna parte del la refutación
    del Cáp. 5 de “E.q.e.u.V”.
    se desacredita “categóricamente”
    la existencia del Jesús histórico compruébelo por usted mismo.
    un saludo cordial…
    atte. Eduardo Cruz.

  180. Walter says:

    Eduardo:
    Sigues copiando declaraciones y yo sigo esperando las pruebas ARQUEOLÓGICAS de la veracidad histórica de la Biblia.
    En cuanto a Lucas, para que éste dé evidencias de Pedro, antes debías presentar evidencias de que Lucas existió, de que Lucas escribió el Evangelio “según” San Lucas, y demostrar que sus narraciones son históricas y no mitológicas..
    Ya te puse un ejemplo claro que no basta que la novela se encuadre e locaciones reales ni que algunos de los personajes sean históricos, para que la novela se convierta en historia. Por ejemplo: Lucas menciona a Herodes el Grande, y sabemos que existió, y que era muy sanguinario. ¿Eso es prueba la historia evangélica de la matanza de niños por Herodes, y demás, es cierta?
    Sobre tus variadas y escuetas afirmaciones:
    *¿Qué testigo ocular usa su derecho de replica, cómo lo hace y que es lo que replica?
    *Sigues hablando de evidencias sin presentar absolutamente ninguna. Salvo que creas que bastan las afirmaciones de los apologistas que citas hasta el cansancio.
    *Sobre la predisposición a lo sobrenatural, no es un prejuicio dogmático, es la simple analogía con nuestra experiencia cotidiana. Nunca hemos visto ni comprobado que exista nada sobrenatural, ¿Por qué habríamos de creer que antiguamente las leyes naturales se comportaban de otra manera?
    *Vuelves a hablar del trabajo arqueológico sin mencionar ninguna prueba arqueológica.
    *No dices cuales son los manuscritos adicionales “más antiguos que la Biblia” ni como prueban su historicidad
    *Hablas del 90% de verdad de la Biblia, ¿podrías poner ejemplos?
    *Si no solo te basas en McDowell podrías decir en quienes más te basas, siempre es bueno referenciar las citas que transcribimos.
    *Nadie trata de desacreditar a ningún Jesús histórico. Solo se refutan las supuestas pruebas que presentan los apologistas para afirmar su historicidad. Mientras no tengan pruebas irrefutables, más allá de la fe, Jesús es solo un mito.
    Walter

  181. Eduardo Cruz says:

    Romanos 1. 22 dice:
    “Profesando ser sabios se hicieron necios…”
    dicho de otra manera mas coloquial;
    ” No hay peor ciego que el que no quiere ver… ”
    y por favor no se apresure a comentar que
    no mencióne ( yo ) a la Biblia
    cuando usted mismo usó la frase de
    “pongo la otra mejilla”
    en una de sus primeras respuestas
    hacia mi persona
    P. D.
    solo téngame paciencia
    que esto se lleva tiempo.
    Las respuestas de microondas ante estos temas delicados…
    realmente no sé que tanta confiabilidad
    pudiesen tener.
    Cuídese Usted y su familia
    (solo no se me ofenda por favor)
    Saludos.
    atte. Eduardo Cruz.

  182. Walter says:

    Parece que Marta es de las que opinan que es equitativo “MATAR AL QUE INSULTA A TU DIOS”, pues se ha sentido personalmente aludida por el calificativo de “descerebrado” que lancé a quienes piensen así.
    Lamentablemente no tiene más ideas y vuelve a irse por las ramas espinosas de la agresión personal. No importa, vuelvo a poner la otra mejilla.

  183. Martha says:

    Mira al conejo hablando de orejas. Solo un “cerebro atrofiado” leyendo la Regla de Oro que dice “Haz a otros como quieres que te hagan a tí”, lee “SI INSULTAS A MI DIOS TE MATO”. La Regla de Oro es para las relaciones interpersonales, Dios no está por ningún lado, paranoico. Y para que lo entiendas te la voy a dibujar en los términos que vas a entender, quiere decir “Si tu te cagas en todo lo que se te dé la gana alguien te echará encima tu propia mierda”. Gracias por darme tu otra mejilla. ¿Estabas de vacaciones? Toma más vacaciones, tu mente se está secando de tanto repetir los mismos y los mismos ataques a Dios, lo digo porque ya no sabes leer, lo he comprobado.

  184. Walter says:

    No hay apuro Eduardo, tomate el tiempo que consideres necesario.

  185. Walter says:

    Estoy de acuerdo con “Haz a otro como quieres que te hagan a tí” pero no estoy de acuerdo en que eso justifique la quema de un teatro como retribución equitativa a poner una obra teatral que se llame “Me cago en Dios”.
    Un ejemplo muy conocido de las consecuencias de justificar la violencia como respuesta a las expresiones artisticas o a las ideas en general lo grafica la pena de muerte decretada contra Salman Rushdie por los fundamentalistas islamicos porque el escritor “insulto a su dios” con su libro “Los Versos Satanicos”. Segun tus deducciones Rushdie se lo merecería.
    Las creencias son abstracciones mentales que llevan a la gente a extremos irracionales, pero el temor a esa reacción no puede ser razón para que los que no creemos en esas supercherías nos quedemos callados mientras difunden su prédica medieval.
    Y lo dije antes, la “regla de oro” obliga a responder teatro con teatro. idea con idea, y no teatro con incencio o “insulto” con muerte.
    Y también estoy de acuerdo en que Dios no aparece por ningun lado y no se le puede insultar porque no existe.
    Respecto a tu explicación soez, creo que te pinta de cuerpo entero, tanto en lo que a al retorica se refiere como a tu cultura de aforismos.
    Finalmente, no tengo más mejillas que poner y además se que esto te hara mas feliz:
    Me parece que eres una pobre estúpida. Pero, claro, solo es mi humilde opoinión.

  186. Martha says:

    Gala de verborragia descompuesta.

  187. Walter says:

    No, solo te estoy aplicando tu regla de oro.

  188. Eduardo Cruz says:

    Muy aparte que terminaron insultándose usted y Martha
    (lo cual no me incumbe en lo mas mínimo por su puesto)
    Solo le pido que en su disertación rectifique su posición antes de contestar:
    (cita)
    ” Las creencias son abstracciones mentales que llevan a la gente a extremos irracionales, pero el temor a esa reacción no puede ser razón para que los que no creemos en esas supercherías nos quedemos callados mientras difunden su prédica medieval.”
    Uff…
    * Aunque aquí si estoy de acuerdo con ambos, sobre todo usted Walter
    (cita)
    ” Y también estoy de acuerdo en que Dios no aparece por ningún lado y no se le puede insultar porque no existe. ”
    – BINGO!
    y efectivamente Dios NO existe…
    … Él SIMPLEMENTE ÉS…
    y no necesita de nadie que lo defienda
    o que demuestre su existencia
    mientras que nosotros,
    si existimos,
    es solo por que…
    ÉL ÉS…
    ” YO SOY EL QUE SOY ”
    – Éxodo 3: 13 al 15
    Jesús mismo se identifico con este nombre
    – Juan 8: 56 al 58.
    P.D,
    Hey Tranki, Tranki
    No se apresure a responderme molesto.
    y en mi humilde opinión usted es demasiado inteligente
    (sin sarcasmos agresivos)
    como para responder con respuestas de “microondas”
    ante estos temas delicados,
    como se lo dije anteriormente.
    un saludo…
    atte. Eduardo Cruz.

  189. Eduardo Cruz says:

    perdon por lo de “por-su-puesto”

  190. Eduardo Cruz says:

    y lo de pérdon

  191. Walter says:

    Hola Eduardo:
    No “terminamos” insultándonos, Marta se la pasó insultándome en todos sus mensajes, entendí que era por su falta de argumentos y por eso lo deje pasar. Pero finalmente me colmó la paciencia y le apliqué la regla de oro que ella misma puso sobre el tapete: “Haz a otro como quieres que te hagan a tí” Lo malo es que Marta logró su objetivo que era desviar el tema hacia tonterías intrascendentes.
    En cuanto a que te incomode mi “disertación” lo lamento pero no me puedo rectificar porque es lo que pienso. Pero no es un dogma, claro que puedo estar equivocado y por eso entro al foro para que me lo demuestren con pruebas y razonamientos. Por ejemplo, no hay ningún raciocinio en tu afirmación de que “Dios Simplemente Es” esa frase carece de una sustentación lógica y para mi significa “Dios Simplemente Es: UN INVENTO”. Igual ocurre con tu cita del Éxodo, para mí no prueba nada, la Biblia es un viejo libro mitológico escrito por gente ignorante hace más de dos mil años y tiene tantas tonterías que me sorprende que la gente lo tome como sagrado, me parece inclusive que quienes piensan eso no han leído el libro. Yo lo he leído varias veces y es un amontonamiento de leyendas, mitos, mentiras, salvajadas, absurdos, intolerancia, etc. En el foro vecino “Castigo de Dios” he citado unos cien versículos que prueban lo que digo.(También hay una lista de unos 500 Dioses para que escojan los creyentes)
    En lo que respecta a que estés a la defensiva y creas que mis opiniones se deben a mi molestia o que me apuro en responder, pierde cuidado, no es así. Realmente lo tomo con buen humor, con bastante calma y disfruto mucho de los debates de este foro. Puede ser que mi estilo argumentativo se lea agresivo, pero solo es el estilo y solo estoy comentando los temas en discusión. No se lo tomen a la personal, no es un foro social ni un Chat de quinceañeros; no nos conocemos, solo conocemos lo que escribimos aquí.
    Saludos cordiales,
    Walter
    Nota: Esperaré pacientemente las pruebas arqueológicas y las “nuevas evidencias” de McDowell. También las respuestas a diversas interrogantes que te hice. No te apuro, solo te hago recordar.. Lo de las respuestas microondas es porque sigues enviandome citas irrelevantes y afirmaciones sin sustento.

  192. david says:

    La verdad, yo no creo que la Biblia sea un libro inspirado por Dios, y eso, cualquier creyente serio lo podrá saber.
    Si la Biblia, tal como la poseemos hoy en día, hubiera sido inspirada, no habría ningún error en ella.
    A continuación, paso una lista de errores y mitos que contienen la Biblia.
    Mitos
    Génesis:
    Creación en 6 días
    Creación del hombre a partir de la arcilla
    Creación de la mujer a partir de una costilla del hombre
    El árbol del bien y del mal, y la serpiente parlante
    Relato de Caín y Abel
    Diluvio Universal
    La confusión de lenguas en la torre de Babel
    Jonás
    El pez de Jonás
    Josué
    La parada del sol y la luna
    Errores
    Génesis
    Significado de la palabra “Babel”
    Daniel
    Nabónido y Belsasar no son parientes de Nabucodonosor
    Año de la ocupación de Jerusalén por parte de Nabucodonosor
    Empleo de la palabra “caldeo” en el libro de Daniel
    Éxodo
    El maná no llovió del cielo
    Los hebreos no cruzaron el mar Rojo, sino el mar de los Juncos o de las Cañas (esto se debe a un error de la traducción de Martín Lutero)
    Levítico 11, versiculo 20
    Habla de insectos con cuatro patas
    1 Reyes 7, 23
    Se da a entender que el valor del número Л es 3, en lugar de 3,14…
    Evangelio según San Juan
    Jesús convierte el agua en vino: El sabor a borrachera y el contraste con la finalidad profunda de los demás milagros de Jesús nos deja atónitos. Parece que en este caso, a Jesús no le importa llevar hasta la más profunda ebriedad a los presentes. ¿Qué explicación hay para este milagro, que por cierto, sólo aparece en este evangelio?
    Una pista nos la puede dar la fecha en que se celebraba este milagro en la iglesia católica…6 de enero… la epifanía. Esta fiesta celebra la revelación del poder del Señor.
    ¿Y entonces? Pues que desde antes que naciera la iglesia, ya se celebraba el 6 de enero otra fiesta, en la cual se celebraba la manifestación de poder de otro dios pagano, con su milagro asociado al vino: eran las festividades de Dioniso, con su milagro tradicional de manifestación que consistía en convertir agua en vino. En otras palabras, en la leyenda de la boda de Caná se revela el poder divino de Jesús, de la misma manera como era narrada la manifestación del poder divino del dios pagano Dioniso. El 6 de enero pasó a ser el día de la manifestación del dios cristiano Jesús, y desplazó al día de la manifestación de Dioniso que hasta ese entonces, se había celebrado el 6 de enero. Dioniso hacía que en su templo en Elis, en el día de su fiesta, tinajas vacías se llenaran de vino y en la isla de Andros fluía de una fuente o en su templo, vino en vez de agua. El milagro de la fiesta de Caná no fue la transformación de agua en vino sino la transformación del dios cristiano en una especie de dios del vino. Como dijo el gran teólogo y exegeta evangélico Rudolf Bultman, en su “El evangelio de Juan”: “Sin duda, la historia (de la boda de Caná) fue tomada de una leyenda pagana y transferida a Jesús”.
    Afortunadamente para los creyentes serios, no se tienen que preocupar por la grosería de Jesús con su madre…este relato, en opinión de la mayoría de los teólogos modernos, es sólo una fábula.
    Tampoco creo que Jesús naciera de una mujer virgen, y que un ángel avisara a José de las pretensiones de Herodes.
    Estos son unos de los errores, mitos y leyendas de la Biblia que he percibido.
    Con ello no quiero decir que nadie la lea, ni que sea un libro dañino y mucho menos pretendo insultar a nadie.
    Es un libro que me ha ayudado mucho para todas las cuestiones de mi vida.
    Un saludo

  193. david says:

    Algunos de los errores que he indicado se encuentran en el enlace que Walter ya mencionó http://www.geocities.com/torosaurio/
    Aunque he de decir que no estoy de acuerdo con todas las afirmaciones que hay en él.

  194. Walter says:

    Hola David:
    Muy buena, especialmente la de la transformación del agua en vino. Me parece que al igual que esa leyenda “pagana” hay muchas otras convertidas en cristianas; voy a leer más sobre Dioniso y otros cultos de esa epoca. Gracias.
    Si quieres ver un análisis excéptico de la Biblia, versículo por versículo, y de paso practicar tu inglés, te recomiendo el sitio web llamado “SAB” Skeptic’s Annotated Bible.
    http://www.skepticsannotatedbible.com/
    Te permite seleccionar por especialidades: Injustice, Absurdity, Cruelty and Violence, Intolerance, Contradictions, Family Values, Women, Good Stuff, Science and History, Interpretation, Prophecy, Sex, Language, Homosexuality.
    Esta la Biblia completa y tiene además enlaces interesantes, pòr ejemplo, para las respuestas de los cristianos. Tambien hay una versión equivalente sobre el Corán.
    Saludos
    Walter

  195. Walter says:

    Fe de erratas: Escribí “excéptico” por “escéptico”. También meto seguido la pata en los acentos pero de eso culparé a mi teclado que a veces no los marca ¡y a mi descuido!, como no.

  196. Martha says:

    Yo no te considero estúpido Walter, a pesar de tus excesos, simplemente eres alguien que piensa diferente, pero como ya me dijiste estúpida, alguien te considerará estúpido en un futuro no muy lejano, no hay remedio, así es la vida… la “Regla de Oro”…
    Y hablando de tonterías intrascendentes esta página se llama “¿Viva Cristo Rey?” y eres tú la muestra viva del asunto que trata. Criticas agriamente la reacción de algunas personas a una obra teatral de suigéneris nombre, y mira cómo tú te pones con tu amarga e inconmensurable humildad, y eso que yo no me he cagado en nada que ames mucho. Humanidad en acción, visceral, emotiva. No estás de acuerdo en que se conteste teatro con teatro, insulto por insulto, segun tú no es civilizado, pero de inmediato y “civilizadamente” me aplicas la “Regla de Oro”, según tu interpretación, que no tiene nada que ver con lo que significa. Te falta aprender tanto Waltercito. Qué ternura me das! Con seguridad un día te tomará Dios. No perderé la esperanza.

  197. Martha says:

    Este espacio no debería llamarse “La Opinión Alternativa” porque de alternativo no tiene nada, debería llamarse “Rincón del Recalcitrante Ateísmo” porque es lo único bien recibido, con paradojas como que se menciona tanto a Dios que supera a todas las iglesias juntas. Como ejemplo Pepa hace mención del Huracán Katrina como un evento digno de atención y sale el predilecto estereotipado, incorregible y con ideas fijas mentándole a Dios (???)
    Igual Pepa dice “Mucho os calentais por vanalidades…” Vanalidad no solo es lo superficial sino lo inútil. Si ha habido alguna estupidez aquí, es el haber desperdiciado tanto tiempo precioso en un espacio tan mediocre. Pero no se agiten, ya me voy, les dejo para que para su sanidad mental pueda maldecir en paz. Viertan libremente su veneno no sea que vaya a matarlos súbitamente.
    Junjan aquí queda otra página para que la desaparezcas.

  198. Walter says:

    Marta:
    La “regla de oro” obliga a responder
    teatro con teatro,
    argumento con argumento,
    insulto con insulto
    Y no
    teatro con incendio,
    argumento con insulto
    insulto con muerte.
    Eres una pobre estúpida porque sigues sin entender eso. Porque dejas que tu fe ciega y tu intolerancia medieval te impidan razonar, has renunciado a la lógica y solo te queda el ataque personal y el insulto.
    No te vas porque el foro no sirva, te vas porque no tienes argumentos y tienes que patear el tablero.
    Pero para que no te vayas con las manos vacías, te diré que no se escribe “vanalidades” sino “banalidades”.
    Au revoir
    Walter

  199. Eduardo Cruz says:

    Que lastima que alguien del foro se lleve un mal sabor de boca al retirarse como lo hizo Martha.
    Yo nunca me atrevería a adjudicar un adjetivo calificativo como el que Walter le concede y menos por tratarse de una dama
    que nos dio su punto de vista muy particular.
    Aquí en México un famoso presidente llego a afirmar
    “El respeto al derecho ajeno es la paz”
    (y tambien incluye el derecho a la libre expresión y a la opinión alternativa como acertadamente se llama este foro)
    a lo cual yo añadiría que…
    “la paz…
    no es la ausencia de problemas
    si no mas bien la Presencia de Dios…”
    esa Paz..
    (no subjetiva ni basada en sentimentalismos religiosos o humanos)
    es La que sobrepasa todo entendimiento.
    Y bueno también es divertido comentar y discutir hasta con un poco de buen humor…
    (pero sin caer en el mal gusto de usar el sarcasmo que escarnece)
    aun que finalmente solo es mi muy personal punto de vista
    a lo mejor algo errado pero finalmente muy mío
    y creo que merece respeto así como el de Martha
    o David o Walter o quien sea.
    P. D.
    Ahora tengo doble tarea por que aparte de que “lo prometido es deuda” para mi amigo Walter con respecto a los temas de arqueología;
    también tendré que enviar de paso una respuesta a David con respecto a los “mitos” que el menciona como tales
    (David por favor no confunda usted
    ¨la gimnasia con la magnesia”)
    por que el relato de
    “ El diluvio universal ”
    por ejemplo,
    así como
    “ la parada del Sol y de la luna ”
    como usted lo ha llamado;
    ya han sido comprobados
    (y aunque parecen un cuento de niños
    “ sha la la”, sha la la” )
    Ciertamente le sorprendería investigar un poco mas
    antes de afirmar categóricamente que son solo mitos
    o leyendas.
    saludos cordiales a todos…
    atte. Eduardo Cruz.

  200. Walter says:

    Hola Eduardo:
    Ya que te vuelves a meter en lo que no te concierne, según tu propia declaración, te aclaro lo siguiente:
    La paciencia tiene un límite y si en lugar de argumentar van a irse al ataque personal, terminaré respondiéndoles igual.
    Y en eso de que por ser mujer debemos tratarla diferente, me parece un prejucio machista.
    Saludos
    Walter
    PD: Voy a agregar a la lista de espera las pruebas que aportarás comprobando que hubo un Diluvio Universal y de que el Sol y la Luna de detuvieron. (Espero que sean evidencias concretas y no ¡más citas bíblica o de apologistas del creacionismo! por favor)

  201. Junjan says:

    jajaja esto está que arde….

  202. Walter says:

    El tema del foro es complicado para los creyentes pues sienten que han ofendido al objeto de su veneración. Nos exigen que por respeto a su creencia, nos quedemos callados.
    Para que comprendan el punto de vista de los no creyentes y que no hay ningún ánimo de ofenderlos a ellos personalmente les pongo el siguiente ejemplo:
    Montamos una obra teatral que se llama “Me cago en Hitler”. El dia del estreno una banda de neonazis nos queman el teatro indignados por que insultamos al objeto de su veneración. Entonces los creyentes hitlerianos nos dirán, se lo tienen merecido por insultar a Hitler. También entrarían al foro a exigir que por respeto a su creencia los no creyentes en Hitler nos quedemos callados. Y cuando debatamos en el foro los no creyentes les daremos cifras del genocidio judío mientras los creyentes neonazis nos diran que no creemos en Hitler porque somos unos malditos comunistas que no comprendemos el elevado mensaje hitleriano y rezarán porque un día Hitler habite en nuestros corazones.
    Para los cristianos que piensen que la comparación es injusta les recuerdo que segun la Biblia su Dios EXTERMINO TODA LA VIDA DEL PLANETA (menos a 8 personas) con un Diluvio Universal porque no lo obedecían ni lo adoraban como el queria, aunque no se explica como acabó también con criaturas inocentes, con los niños que ni sabian hablar, o con los pueblos que ni sabian del dios judio, o con los animales que no le habían hecho nada. Acabo con todo. GÉNESIS 7 Y 8 2; 2 PEDRO 2:5.

  203. Walter says:

    Post data: Me olvidaba de algo: Y los creyentes nazis como único argumento ¡nos bombardearán con citas de “Mein Kampf”! jajajajaja

  204. david says:

    Hola Eduardo:
    Sobre el Diluvio Universal, ve el enlace que ya me indicó Walter en “Jesucristo no existió II” http://www.sindioses.org/cienciaorigenes/objecionesgeo.html
    No niego que pudiera haber existido un diluvio de carácter local (como tanto otros, que hay hoy en día)pero cuando leas el enlace comprobarás que es científicamente imposible que un Diluvio inundara la totalidad de la Tierra.
    Las pruebas geológicas de Wooley, eran bancos de arena de distintas épocas cada uno. No prueban nada.
    En cuanto a la parada del sol y la luna: si hubiese sido real (algo que no se ha demostrado) se hubiera parado en todo caso el planeta Tierra, y no el Sol, como narra el libro de Josué.
    Bueno, si quieres intentar demostrar que estas cuestiones fueron reales, estoy abierto a ello, pero que sean pruebas serias. No como por ejemplo, decirme que el Talmud o Marco Aurelio prueban que Jesús existió, cosa que ya no tiene discusión.
    PD: En el enlace que cité en mi comentario anterior, leí otro artículo sobre Jesucristo. Otra leyenda que se le añade es el pasaje del evangelio de Marcos en el que Jesús maldice una higuera ¡por no dar frutos fuera de su temporada! La verdad, considero a Jesús bastante inteligente como para hacer esas tonterías.
    Un saludo

  205. david says:

    Hola de nuevo Eduardo:
    Un error que ha cometido, comete y supongo que cometerá la Humanidad es el de mitificar e hiperbolizar a sus profetas y héroes.
    No sólo pasa con Jesús y los profetas bíblicos, pasa también con Buda, Confucio, Lao Tsé, Muhammad; y también con héroes como el Cid, Juana de Arco, e incluso con el Che Guevara.
    Eso sólo ha servido para hacer más incrédula a la gente o para conseguir más prosélitos.
    A mi, la verdad, me fascina la figura de Jesús y de Buda sin necesidad de tanta leyenda acoplada y añadida.
    La Humanidad he de corregir ese error.
    Insisto en que espero tus argumentos para demostrarme que el diluvio universal y la parada del sol y la luna existieron realmente. Pero al menos coincidirás conmigo en que la Biblia se equivoca diciendo “Sol, párate”. Es decir, el sol no tiene movimiento, sería más correcto decir “Tierra, deténte”. Los que escribieron la Biblia pensaban que el sol giraba entorno a la Tierra, y no al revés.
    Si Dios hubiera inspirado realmente la Biblia, en ella no habría error alguno. En éste punto se equivoca, luego no ha sido inspirado por Dios.
    No culpo a los que escribieron este pasaje, tan sólo procesaban la informacion como la recibían.
    Un saludo

  206. Eduardo Cruz says:

    y detrás de cámaras re-aparece jun jan
    solo para decirme
    ¿eso duele?
    que argumento wow…
    * Efectivamente David..
    que la tierra se detuvo ante el sol y no al revés…
    (ósea no el sol ante la tierra)
    Es desde la perspectiva que se escribió
    y del conocimiento científico hasta entonces conocido.
    Pero también es cierto
    que los científicos no creyentes
    en al actualidad y que han estudiado el tema, afirman en que
    ciertamente hubo un dia muy largo
    y que “casualmente”
    coincide con las fechas
    en que existió el caudillo Josué de la biblia.
    Sobre el diluvio,
    quédo pendiente…
    … pero solo les anticipo que entre Armenia, Turquía y Rusia se encuentra el monte Ararat y el artefacto (arca)
    que se dividió en 2 partes en el siglo 19 por una enorme avalancha de nieve
    y que contiene una especie de “corrales” dentro de ella.
    también se le hizo la prueba del carbono a la madera…
    (que de nuevo coinciden con
    las fechas del diluvio)
    También otras culturas hablan del diluvio.
    saludos.
    atte. Eduardo Cruz.

  207. Eduardo Cruz says:

    P. D.
    no soy “machista”
    solo inténto ser “caballero”
    y no un “barbajan”
    saludos cordiales…
    Eduardo

  208. david says:

    Hola Eduardo:
    Me interesa ese tema del que hablas. Un día más largo de lo normal, respaldado por la ciencia. No digo que no pueda ser cierto, pero me gustaría que pusieras un enlace o alguna fuente que pueda consultar, si no es mucha molestia.
    En cuanto al arca que mencionas, tengo noticias de ella a través de un libro que escribió un historiador judío (no recuerdo el nombre, perdón por ello),que se llamaba “Iniciando en la Biblia”.
    En él se menciona varias leyendas acerca de la supuesta arca (se dice, entre otras cosas que Anastasia llevaba un crucifijo hecho con madera de ella), pero sin embargo, se indica que las posibilidades de que el objeto que se halla en el monte Ararat sea el barco de Noé son muy remotas.
    De todas maneras, si el objeto es verdaderamente el barco de Noé, insisto en que se trataría de un diluvio local, como tantos otros que ha habido, hay y habrá en el mundo y dentro de todas las culturas.
    No se trataría de un diluvio “universal”.
    Te aconsejo que leas el libro que te he indicado, el enlace que cité en mi comentario anterior, y “Guía para la Biblia” de Isaac Asimov.
    Un saludo

  209. david says:

    Hola de nuevo Eduardo:
    Los corrales que supuestamente tiene el arca son mera especulación.
    Sólo muy pocas personas han llegado hasta el Arca ya que la subida al monte Ararat está prohibida.
    Las culturas que menciona el Diluvio, no se basan en el mismo. Hay más diferencias que semejanzas si los lees y los comparas con el relato bíblico, incluso con el Gilgamesh.
    Un saludo

  210. Walter says:

    Hola Eduardo:
    La caballerosidad implica un trato cortés de los interlocutores, no significa tolerar indefinidamente los insultos, vengan de quien vengan. Ahora tu que dizque no te incumbe me insultas llamándome “barbaján”. Seguramente cuando te responda sere yo el que carece de cortesía y caballerosidad, jajajaja.
    Ten cuidado de que tu fe no anule tu raciocinio.
    Walter

  211. Walter says:

    Eduardo:
    Para darle seriedad a este diálogo sería bueno que pongas las fuentes de información en que te basas para lanzar tus frasecitas telegráficas con tan extraordinarias afirmaciones. Y también explicar como y porqué llegas a esas conclusiones. No basta copiar indiscriminadamente frases que te convengan, ni menos generalizar como lo haces cuando dices “los científicos no creyentes” eso no es serio, tienes que decir cuáles “científicos no creyentes”, que es lo que dicen, y lo más importante PORQUE LO DICEN, es decir en qué se basan ellos para decirlo.
    Y si tú no tienes las evidencias, ¿Cómo sabes que es cierto? Y si no lo sabes ¿Por qué lo escribes? Y usas además un tonito categórico muy autosuficiente, jajajaja. Hasta ahora te has limitado a decir cosas inverosímiles sin presentar pruebas ni razonamiento lógico alguno. Por eso se te están acumulando las pruebas que nos debes. Pero así no es la cosa, documéntate ANTES de afirmar algo.. ¿Crees que es serio que primero lo digas y DESPUES busques algo que te respalde?
    En cuanto a los temas, he tenido oportunidad de revisar en el sitio Web de la NASA y lo que dices del largo día (o dia faltante) es una burda “leyenda urbana”, UNA MENTIRA difundida por los justificadores de mitos bíblicos y que no tiene ningún sustento científico. Puedes comprobarlo en http://imagine.gsfc.nasa.gov/docs/ask_astro/answers/970325g.html
    Lo del “Arca de Noé” es lo mismo. No hay evidencias de que haya un arca en Ararat, muchísimo menos de que sea el Arca de Noe. Y no podría haberla pues Noé es un personaje mitológico que nunca existió y el cuento del Diluvio es una COPIA DE TRADICIONES SUMERIAS ANTERIORES A LA BIBLIA (http://es.wikipedia.org/wiki/Gilgamesh). Aún en el supuesto de que encontraran un trasatlántico balanceándose en la punta del Ararat, eso tampoco probaría que hubo un Diluvio Universal, las evidencias geológicas descartan completamente la posibilidad de que en nuestro planeta haya habido una inundación de alcance mundial. Si quieres analizar el tema en serio espero que acudas al enlace que te recomendó David o a cualquier libro de texto de geología. Hasta ahora te has limitado a copiar las afirmaciones delirantes de los creacionistas bíblicos,.
    Walter
    PD: También te recomiendo que no cortes el párrafo cada cuatro palabras, dificulta la lectura, es de mal gusto, desperdicia el espacio, quita fluidez a lo que quieres decir, y no es necesario que hagas parecer como que escribes mucho, usa más bien el resto de la línea para sustentar lo que dices.

  212. Walter says:

    Hola Eduardo y David:
    Comparto con ustedes un nteresante artículo sobre el “Arca de Noe” y el Monte Ararat. Pueden leerlo en el siguiente enlace de la Universidat de Valencia:
    http://mural.uv.es/hecoro/preg2.htm

  213. Walter says:

    Las pruebas del absurdo:
    Si los únicos animales que sobrevivieron al Diluvio desembarcaron en el monte Ararat ¿como hicieron los koalas para llegar a Australia? ¿qué comieron en el viaje? ¿Y como hicieron para entrar en Australia especies, sobre todo marsupiales que no hay en otros lugares del planeta? ¿Y porqué algunas especies fueron sólo a una región y no a otra?
    Aquí van algunas respuestas:
    “Supongo que había una gran señal en alguna parte en el Sur oriente de Java, con una inscripción que decía: Zona de la Cuarentena celestial: Ningún Mamífero placentario, con la excepción de roedores y los precursores genéticos del Canis familiaris dingo (el dingo) pueden transportarse o deambular más allá de este punto. Las especies marsupiales americanas deben tomar la ruta del Estrecho de Bering. Mapas disponible en la oficina de estación de cuarentena.” (Horas de Oficina 9:00 A.M. – 5:00 P.M.) –Peter Lamb, Talk. Origins Newsgroup. 30 de abril de 1996
    “El monstruo mexicano del Gila y el lagarto barbado (los únicos miembros de la familia Helodermatidae), desembarcaron del arca, pero escogieron no quedarse en los inconvenientes desiertos asiáticos. En cambio, viajaron a través de Siberia para llegar al Sudoeste americano por el puente tierra de Bering, por Alaska, y Canadá, para llegar al suroeste americano. ¡Lograron este hecho durante la misma Edad de Hielo que, según los creacionistas, diezmó a los dinosaurios y enterraron a los mamuts!” Una proeza -Robert A. Moore, El Viaje Imposible del Arca de Noé.
    “Los osos perezosos son tan lentos que el musgo crece en su pelaje. Cuando ellos mueven, que no es lo frecuente, les toma tres horas y media pasear una milla. Su metabolismo es tan bajo que holgazanean en los árboles y absorben los rayos del sol durante la parte mayor del día. Me pregunto cómo llegaron a las selvas de América del Sur los dos perezosos, cuando desembarcaron del arca de Noé. ¿Caminaron por Asia, a través del desierto frío de Siberia del norte, cruzaron Alaska, y luego caminaron hasta América del Sur para ponerse calurosos de nuevo? Todo un record roto por los perezosos. ¿Qué comieron en su travesía? ¡Qué buen libro de aventuras sería, con los efectos postcataclísmicos del Diluvio acechando cada uno de sus pasos. ¡Ojalá que esa historia estuviera en la Biblia!”

  214. Walter says:

    Me olvide del enlace, hay más objeciones sabrosas a la tontería diluviana:
    http://www.sindioses.org/cienciaorigenes/objecionesbio.html

  215. david says:

    Walter:
    Estoy de acuerdo contigo en que el dia faltante es una leyenda urbana.
    En cuanto al enlace sobre el Arca, me parece interesante.
    Un saludo

  216. Walter says:

    Hola David:
    Sobre la leyenda urbana del dia faltante de Josue, no tendría importancia que lo diga yo; lo importante es que lo dice la NASA.
    Saludos muy cordiales,
    Walter

  217. Federico says:

    Ahora resulta ?
    que el “juez” de este foro se llama Walter,
    que el “jurado” se llama David
    y el acusado acaso sera ¿ Eduardo ?
    como si la palabra de este disque “juez” fuese la ultima
    y sus resoluciones absolutas
    ja ja…
    me olvidaba que papel jugará jun juan en este “juicio” ?
    federico.

  218. david says:

    Federico:
    Deja las drogas que son malas

  219. Walter says:

    Hola Federico:
    No es Eduardo, ni nadie, quien está siendo juzgado SON LAS OPINIONES LAS QUE SE JUZGAN. Y todos nos erigimos en jueces de las opiniones ajenas cuando nos encontramos en un debate. Tú también nos juzgas con tus comentarios, y también tienes la última palabra, hasta que alguien te refute. Por ello, es injusto que digas que pretendo tener la última palabra porque tienes la libertad para refutarme. Espero que lo hagas.
    Otrosí digo: Siguiendo tu parodia judicial, te has autonombrado “Abogado Defensor” de Eduardo, jajajaja. No creo Eduardo necesite ayuda, pero es tu prerrogativa si quieres hacerte cargo de la defensa. Sería interesante saber qué pruebas presentas en su descargo, pues tu cliente ha hecho bastantes afirmaciones muy difíciles de sustentar.
    Walter

  220. Walter says:

    El llamado Junjan es dueño de este foro y puede borrarnos del mapa o censurarnos cuando le venga en gana. Además es un condenado ateo que favorece descaradamente las opiniones anticristianas y hace, él mismo, proselitismo contra la Santa Madre Iglesia (Debe estar en la lista de el Santo Oficio para las hogueras de un eventual retorno a épocas mas santas). ¡Se imaginan que dice que Jesús jamás existió y que es un invento de los fundadores del cristianismo! ¡Cómo va a ser imparcial!
    Los creyentes que se sientan ofendidos por este blog hereje, pueden encontrar foros cristianos en donde la mayoría de los participantes SI creen que la Biblia es la Palabra de Dios y no aceptan nada que la contradiga, nadie te juzga por tu falta de argumentos ni les interesa hablar de nada que cuestione el dogma cristiano. Allí se aceptan las cosas por fe y nadie te pide estúpidos razonamientos lógicos, ni pruebas ni evidencias de nada. Basta la inspiración divina ¡Aleluya!
    Por ejemplo pueden visitar
    http:/http://www.foroekklesia.com/
    Hay bastantes testimonos de milagros, ciencia bíblica, arquelogía bíblica, historia bíblica, lógica bíblica, etc. además pueden hacer amigos en las redes de amistad cristiana, o leer poemas devocionales, pedir favores a dios en las capillas de oración, etc. Hasta lles regalan estampìtas.
    Walter

  221. Walter says:

    Estaba poniendo en otros foros las refutaciones al resumen del “Lic Eduardo Cruz” sobre las “Evidencias” de McDowell, tal como le ofrecí; y aqui van algunas respuestas que le dieron en : http://menteabierta.infopop.cc/groupee/forums
    NUEVA EVIDENCIA EXIGE UN VERDICTO (sobre la resurrección de Jesús)
    Esa evidencia según McDowell es la siguiente:
    quote:
    Esto es lo que los hombres han hecho al rechazar como verídica la resurrección de Jesucristo, aún antes de comenzar siquiera una diligente investigación histórico-bibliográfica seria.
    Lo normal es que se tenga por verídica es resurrección después de la investigación histórica y no antes. La aceptación de la resurrección de Jesús, desde un punto de vista escéptico y no religioso, debe ser posterior a la presentación de estudios y pruebas claras y concluyentes de que tal resurrección tuvo lugar y no antes. Son los creyentes los que creen que algo es cierto sin pruebas, solo por fe. Y me parece muy bien. Están en su papel.
    quote:
    Estas presuposiciones no tienen fundamentos, sino más bien son prejuicios filosóficos para auto-justificarse llamando “escepticismo” a su incredulidad y dureza de corazón.
    ¿Acaso la credullidad y la “blandura de corazón” garantizan la verdad de la resurrección? Aquí no se trata de cuestiones filosóficas. Es muy sencillo: ¿Hay o no hay pruebas de la resurrección de Jesús?
    quote:
    Pero Según la carta de Pablo a los Hebreos (11:1) “la fe es la certeza de lo que se espera, la convicción de lo que no se ve” (no la emoción de lo que sí se ve); a diferencia lo que puede llamarse fábula, mitología (o mito), cuento, novela, leyenda o alguna extraña filosofía donde finalmente se apela más a las emociones que a la razón (ó a los hechos históricos reales); y es que en realidad no es tan importante la cantidad de fe que uno pudiera llegar a tener, sino en donde (o más bien en Quien) esta depositada; esto es lo que le da el verdadero valor.
    Ah ¿pero esto de la resurrección y todo lo que dice la Biblia es cuestion de fe? ¿nos olvidamos entonces de las supuestas pruebas? ¿Consisten esas pruebas en simplemente decir que sí a todo lo que diga San Pablo y la Biblia?
    quote:
    puesto que la mayoría de la gente rechaza a Cristo por una o más razones:
    ignorancia, orgullo, problema moral,
    y pone ejemplos de cada una. Y no se le ha ocurrido a este señor que hay gente como yo que simplemente no creen en esas cosas porque no se apoyan en pruebas racionales y son un conjunto de antiguas creencias irracionales, difíciles de creer si n es por la fe? ¿No se le ha ocurrido que simplemente hay personas que no tienen fe? ¿o que tienen otra fe?
    Luego explica una serie de peculiaridades de la Biblia que la hacen un libro único, como si esto le confiriera mayor veracidad o como si esto justificara en lo más mínimo algo tan absurdo como la resurrección de una persona muerta. Que si es muy antigua, que si ha sido escrita por multitud de autores, que si su confiabilidad histórica ha sido comprobada por la arqueología, que si es el libro más leído del mundo, que si fue escrita en tres idiomas y así sigue … Ahora resulta que la veracidad de un libro le viene dada por su antigüedad o por estar escrito en varias lenguas. Ya se lo que tengo que hacer para que todo lo que deseo se haga realidad. Lo escribo en un papel en varios idiomas y hago doscientos mil millones de copias. No lo puedo hacer antiguo, pero algo habré hecho. Por otra parte los vedas, que son más antiguos que la biblia deberían de ser más ciertos y la Iliada y la Odisea dadas su antigüedad y su difusión a nivel mundial deben tener mucho de verdad. Seguro pues, que las sirenas existen. También el Quijote debió de existir y lo mismo Sancho Panza, dada laantigüedad de la novela, su difusión y la confirmación arqueológica de la existencia del Toboso, Barcelona o Argel, que se mencionan en la novela.
    Fuera de bromas. A mí me parece que la existencia de Jerusalén, del Monte de los Olivos, del Templo judio no están en duda. Sino la resurrección de una persona. Y la Biblia en el NT simplemente la menciona, pero no aporta pruebas ni existen fuera de la Biblia otras referencias a que ese hecho ocurriera. Por otra parte la Biblia no es un libro de historia, sino religioso. Su fin no es documentar la historia sino mantener una fe. Y como tal puede decir que Jesucristo ha resucitado o que se ha reproducido por partenogénesis. Pero lo lógico es que sean los creyentes en esa religión lo que lo tengan por cierto, no los que no son creyentes. No sin pruebas.
    Los historiadores como Tácito, Suetonio, o Flavio Josefo hablan de Jesucristo, pero no dan por hecho su resurrección. En todo caso ninguno de ellos conoció a Jesús, así que hablaban de oídas. Y por supuesto ninguno asistió a ninguna resurrección ni la menciona en sus escritos como un hecho, sino a lo sumo como una creencia de los cristianos. En todos esos escritos los autores sólo cuentan la historia de los cristianos y suponen implícitamente la existencia de Jesucristo, pero no aportan ninguna prueba ni testimonio independiente.
    El que Jesús desde el punto de vista histórico sea un personaje importante que parte la historia en Dios, este es un hecho que no ha dependido de Jesús mismo sino de los que han construido una religión en torno a él. Y tampoco esto es prueba de nada.
    quote:
    He aquí el registro completo ( como escribió G. B. Ardy) :
    Sepulcro de Confucio – – – – – – Ocupado
    Sepulcro de Buda – – – – – – Ocupado
    Sepulcro de Mahoma – – – – – – Ocupado
    Sepulcro de Jesús – – – – – – VACIO…
    He aquí las falsas teorías urdidas para refutar la resurrección:
    “La Teoría y el Veredicto”:
    1. La teoría del robo. ( Del cuerpo de Jesús ) Imposible e insuficiente.
    2. La teoría del desmayo. (Del cuerpo de Jesús) Imposible.
    3. La teoría de la alucinación. ( De los discípulos ) Un disparate.
    4. La teoría de la equivocación. ( De la tumba ) Ingeniosa pero insuficiente.
    5. La teoría de la incineración (Del cuerpo de Jesús ) Ingeniosa pero imposible.
    6. La teoría de la falsedad del relato ( De la resurrección de Jesucristo )
    y que éste (el relato) fue una “añadidura posterior” …
    ¡No soporta el escrutinio estrecho!
    7. La EVIDENCIA (de la RESURRECCIÓN DE JESÚS)… Elocuente.
    ( ¡Todas las teorías quedan totalmente refutadas! )
    ¿Por qué la teoría del robo es imposible e insuficiente?
    ¿Por qué la del desmayo es imposible?
    ¿Por qué la de la alucinación es un disparate?
    ¿Por qué la de la equivocación es ingeniosa pero insuficiente?
    ¿Por qué la de la incineración es ingeniosa pero imposible?
    ¿Por qué la de la falsedad del relato y que fue una añadidura posterior no soporta el escrutinio estrecho?
    Hay quien cree que Jesús sobrevivió, viajó a Cachemira y allí está su cuerpo.
    Por otra parte el hecho de que esas teorías haya que rechazarlas no implica que haya que aceptar la resurrección. Pude haber más explicaciones. Hay incluso quien cree que fue abducido por los extraterrestres. Si, ya sé que no es creíble. Pero tampoco es creíble que un muerto vuelva a la vida. De hecho para mí es más creíble lo de os extraterrestres. Si se afirma que Jesús resucitó habrá que probarlo, no rechazar las posibles pruebas de otras hipótesis.
    quote:
    “Este simplemente es el resumen de un libro que impacto mi vida, y claro, nunca va a sustituir a la Biblia, la palabra de Dios; pero ha reforzado mi fe en ella, en la iglesia cristiana, pero sobre todo en la deidad de Jesucristo y simplemente mi objetivo fue recopilar lo más importante e interesante para compartir de una manera diferente a los que no conocen a Jesucristo como su único y suficiente Salvador y Señor de sus vidas”.
    Eso sí. Para reforzar la fe si que sirve este libro. Creo que ese es su propósito y no demostrar nada. La fe no es demostración, sino aceptación sin condiciones y sin pruebas. Y creo que es evidente que este libro trata de eso.
    ——————-
    HOLA QUE TAL
    solo una inocente pregunta don Eduardo,
    Que paso con jesus despues de volver a la vida; que hizo, no creo que se haya ido al cielo pues ese es un lugar espiritual y el era cuerpo o no????????
    Entonces digame ¿que hizo? ¿caminó por la tierra? si fue asi entonces tuvo que morir o sigue vivo hasta ahora.
    un saludo
    —————–
    ANAXIMANDRO

  222. Walter says:

    Nota: La refutación anterior tambien es de Anaximandro, del 19 de Octubre del 2005.

  223. Walter says:

    Tambien encontre en http://foro-gratis.latin-foros.com/posting.php?mforum=cristianos
    que muchos de los comentarios que imprime Eduardo son meras copias de lo que ya puso alli, incluyendo menciones que hace hoy dia sobre las conversaciones de este foro. Lo gracioso es que ali publica sus mensajes sin que nadie le responda. Para que no se vea como un dialogo de uno, le estoy copiando algunas respuestas de aqui.

  224. Walter says:

    Bueno, termine de copiar la respuesta a Eduardo en varios foros donde encontre su escrito inicial sobre McDowell, me parece interesante destacar que en todos ellos se publico de inmediato mi mensaje, excepto en dos, ya adivinaron, estos dos son foros apologistas cristianos y mi mensaje ha pasado a evaluacion antes de ser publicado, jajajaja, ojala que apruebe.

  225. Walter says:

    Con respecto al mensaje de “Anaximandro” en Octubfre del 2005 sobre las supuestas evidencias macdowelianas del Lic. Eduardo Cruz, cabe destacar que no tuvo ninguna respuesta ni comentario de parte de Eduardo.

  226. Walter says:

    Continuando con mis visitas a otros foros me encontré con los problemas que tiene el cristianismo y su amplia fragmentacion en cientos de denominaciones de diverso tipo, pueden comprobar su ridiculez con este candoroso diálogo entre dos cristianos evangélicos, lo transcribo tal cual, es decir con errores ortográficos incluidos.
    ———————
    01/03/06
    Estimado Federico,
    Primero, según tus aportes, las señales que ocurren en las denominaciones que doptaron la Visión G12, son del diablo, porque, dicha Visión es herege. Ahora resulta que las señales de la denominación Dios es Amor, también son del diablo. Yo pregunto : Son del diablo por el mismo motivo o crees que los milagros de Dios se terminaron con la muerte de los apóstoles, como sabes cuando es Dios el que opera un milagro y cuando es el diablo??? Nos hace falta saber cuales son esas denominaciones CRISTIANAS que PRACTICAN EL OCULTISMO o si no, dinos cual es la tuya, para así poder descaratar todas la demàs Gracias por sacarnos de la confusión
    €Manuel
    ——————————————-
    No terminaron con la muerte de los apostoles ni nada de eso las señales hacian los apostoles eran manifestaciones del Espiritu de Dios,el cual es Dios la tercera persona de la trinidad(La cual dices que no existe).Pero no veo los apostoles usando chamanes,amuletos magicos,agua bendita,Rosas magicas ni nada de esas cosas heredadas del espiritismo.No me e retractado en mi postura respecto a la vision(G12);sino he decidido jusgar los hechos de una mANERA NO prejuisiada aun asi sean dos o tres G12 sino practican actos que no van conforme ala verdad Biblica hay que cuestionarlos.Respecto alos dones y alas lenguas hay Bautistas que hablan en lenguas y luteranos como hay evngelicos que no creen en estos.Sobre los adventitas nada tienen de cristianos para ellos el sabado es su vida y su cruz.¿por que me citas a los adventistas que no se incluyen en el consilio se iglesias cristianas?YO fuy mienbro por cinco años de la Asambla apostolica de la fe en cristo jesus (solo jesus)negaban la trinidad y decian que todo el que no era bautisado en el nombre de jesus estaba fuera de la gracia de Dios.Razones por la que coji una Biblia y creo en la trinidad y en el Bautismo en nombre de esta.¿No son de Dios los apostolicos por esto?en ninguna manera solo son pequeños errores doctrinales;pero cuando tu me hablas de una iglesia que predica el uso de talismanes,agua bendita,flores magicas,regreciones,pacto de generaciones.Esas Iglesias que te dicen que si eres pobre estas en pecado.¿son de DIOS DICHAS PRACTICAS?¿LO HONRAN COMO DIOS VERDADERO? sin mas DIOS TE BENDIGA.
    Federico
    —————————–
    Nota: // El G12 es un movimiento evangelico originado en Colombia por un tal Castellanos que se basa en la numerología del 12 de la Biblia (12 tribus, 12 apostoles, etc.) y propugna una organización piramidal de la Iglesia en células de 12 activistas. Las demas confesiones evangelicas los acusan de sectarios, satanistas y apostatas. // La Iglesia Pentecostal “Dios es Amor”, fue fundada por un tal Miranda en Peru, a quien Dios en persona dijo que todos los que acudan a su iglesia seran curados de lo que sea (incluso de cancer y sida), serán liberados y serán “prosperados” //
    ¡Que bonita familia! jajajaja.

  227. Walter says:

    El dialogo anterior aparece en http://www.labibliaweb.com/foros/archive/index.php/t-633.html
    por tanto el Federico que aparece allí no debe confundirse con Federico que escribió en “Op.Alt.”

  228. Walter says:

    Hola David.
    Te paso un par de enlaces que te interesarán, contienen las conclusiones del arqueólogo Israel Finkelstein, director del Instituto de Arqueología de la Universidad de Tel Aviv, sobre busqueda de evidencias arqueologicas bíblicas:
    http://www.sindioses.org/examenreligiones/arqueobiblica.html
    http://es.news.yahoo.com/10042006/159/arqueologo-revisa-mito-david-salomon.html
    Saludos
    Walter

  229. me descubrieron says:

    Los machistas les aguantan a las mujeres como los machos. Los que no son machistas, les pegan….

  230. david says:

    Hola Walter:
    Me ha gustado los dos enlaces que me has mandado.
    Aunque no estoy de acuerdo con algunas afirmaciones por considerarlas especulativas, he aprendido mucho.
    Gracias
    Un saludo

  231. FABIAN says:

    los que blasfeman contra Dios estan mas que perdidos

  232. Walter says:

    No te preocupes, ni tengas temor de nada, Fabian, porque Dios no existe.

  233. Walter says:

    Por fin apareció el buen Eduardo Cruz en otro foro, este se llama “Dios es Amor” y les doy el enlace al final. Dice:
    “Sir Walter
    Si no mal recuerdo a partir del dia 9 de marzo empecé a dialogar con usted en otro foro llamado la opinión alternativa- viva cristo rey y ahí comenzó usted a recibir algunas de mis respuestas *¿que no lo recuerda?* Se que su escondida intención es la de escarnéceme pero no se preocupe, como usted dijo
    “pongo la otra mejilla”
    por cierto me acusa usted e copiar y regar este comentario por varios sitios de la red. pero…¿no hace usted lo mismo con sus cuestionamientos *ya contestados*?
    un saludo
    Eduardo Cruz. (20/04/2006)
    http://foro-gratis.latin-foros.com/tema-4-0–15-cristianos.html
    Le respondi:
    Hola Eduardo:
    Por fin te encuentro. Ten la certeza que no hay ninguna intencion mia de escarnecerte, solo que te fuiste del foro sin responder nada de lo que te pregunte y despues de que me ofreciste repetidas veces presentar pruebas de tus extraordinarias aseveraciones. Lo de “perseguirte” es una broma y la remarque con “jajas” sinceros, no burlones; la rectifico por “hacer el seguimiento a tu respuesta”
    Es injusto que digas que te acuso de copiar cuando yo copio igual, pues yo te ofreci hacerlo cuando encontre tu apologia macdoweliana en Opinion Alternativa y en mcuhos sitios de la red. A diferencia tuya dejo constancia de que lo hago asi.
    Para que recuerdes como es la cosa cito aqui:
    Dije: “Nota: Voy a tratar de tomarme un tiempo para publicar mis respuestas en todos los foros en donde aparece tu escrito.” Marzo 4, 2006
    Respondiste: “Me parece una falacia su posicion seudo-intimidante y disque-amenazadora con la cual concluye usted su ultimo mensaje dirigido hacia mi persona y ante la cual estoy temblando pues me ha robado el sueño! pues de esto se trata cuando se intenta discutir y aprender de otros en un debate abierto por el Internet ” Marzo 9, 2006
    Respondi: “Finalmente. no voy a publicar mis respuestas por intimidarte, lo hare por refutarte en todos los lugares en donde has copiado tu comentario en cadena porque es justo ¿no crees? ¿O no quieres que te refuten?” Marzo 9, 2006.
    Como cristiano sabes que es un pecado mentir, asi que considerare que te has confundido. Mis cuestionamientos nunca los contestaste, te has limitado a refutar con mas propaganda religiosa sin usar ningun razonamiento ni evidencias para sustentarlos.
    No te olvides que ofreciste:
    -Nuevas evidencias obtenidas por McDowell los ultimos 20 años y que no habian sido refutadas.
    -27 documentos que prueba que Jesus es historico
    -Pruebas arqueologicas de la historicidad de Jesucristo y de la Biblia.
    -Pruebas de que el Sol y la Luna se detuvieron tal como dice la Biblia en la historia de Josue.
    -Pruebas de que hubo un Diluvio Univrsal
    Si estas pruebas o las respuestas a que aludes las pusiste en Opinion Alternativa, se extraviaron. ¿Podrias ponerlas aqui?
    Un saludo fraterno,
    PD: Para que recuerdes que no me respondiste y que te fuiste debiendo pruebas que ofreciste afirmando que “lo prometido es deuda” cito tus últimos comentarios en el foro aludido:
    Dijiste: “Ahora tengo doble tarea por que aparte de que “lo prometido es deuda” para mi amigo Walter con respecto a los temas de arqueología; también tendré que enviar de paso una respuesta a David con respecto a los “mitos” que el menciona como tales (David por favor no confunda usted ¨la gimnasia con la magnesia”) por que el relato de “ El diluvio universal ” por ejemplo, así como “ la parada del Sol y de la luna ” como usted lo ha llamado; ya han sido comprobados (y aunque parecen un cuento de niños “ sha la la”, sha la la” ) Ciertamente le sorprendería investigar un poco mas antes de afirmar categóricamente que son solo mitos o leyendas. Abril 13 , 2006
    ——

  234. Eduardo Cruz says:

    Se equivoca Walter
    aun no me despido…
    un saludo a David
    atte Eduardo Cruz.

  235. Walter says:

    Que bien Eduardo:
    Si aún no te despides….
    sería buen momento
    para que pases
    “las pruebas”
    que ofreciste.

  236. Walter says:

    Aunque no comparto su posición respecto a la historicidad de Jesucristo, es interesante el análisis de los evangelios que aparece en el libro siguiente:
    http://esnips.com/doc/25b52466-581e-4599-b51f-4923f526ae92/EsVerdaderoElCristianismo.zip

  237. karina says:

    bueno tu contexto esta vien y quiero decir que es perfecto .

  238. Walter says:

    Una mas del “Lic” Eduardo Cruz:
    El tal “Lic” Eduardo Cruz siguio pegando los mismos escritos que copio en este foro en muchos otros blogs de la red. Tal como le ofreci pegue las respuestas que di aqui, en todos los foros en que lo encontre.
    Fíjense en su ultimo comentario:
    http://rudd-o.com/archives/2005/05/23/un-posible-argumento-en-contra-de-la-fe/
    # Eduardo Cruz says:
    May 25th, 2006
    Y soy yo el que “copia y pega” comentarios sin sentido…
    un saludo.
    atte Eduardo Cruz
    —————–
    Mi respuesta fue la siguiente:
    May 25th, 2006
    Hola amigos:
    Si visitan los foros “Dios es Amor”, “Kimniekan”, “Blog de Amuchamu” y “Opinion Alternativa”, entre otros, encontraran la propaganda religiosa del tal “Lic” Eduardo Cruz y verificaran que sus mensajes son simples copias que pega de un lado a otro igual que las nefastas cadenas de email, no espera dialogar con nadie ni busca razonar ni encontrar verdad alguna, solo hace propaganda. Yo solo copio mis respuestas para evitar que se sorprenda a otros foristas con sus mentiras proselitistas.
    Ahora el tal Lic. Eduardo, actúa como el ladron que grita al que le persigue, “ese es el ladron”, un ejemplo muy cristiano de amor al projimo. Pero eso no tiene importancia. Pidanle pruebas y veran que no vuelve a aparecer por aqui tampoco.
    Y no es una cuestion personal pues ni lo conozco. Solo le hago el seguimiento pues me parece muy nociva su pose de supuesto “Lic” que usa para dar peso a sus mentiras y engañar a los lectores. Peor aún, cuando despues de un amplio debate en Opinion Alternativa, el señor Cruz se corrio sin presentar las pruebas que ofrecio. Y son las pruebas de las mismas afirmaciones que hace en este y otros foros que sigue anunciando sin presentarlas. Veamos si ahora entra en el tema de fondo y presenta pruebas:
    ¿Cuales eruditos no creyentes comprueban la existencia historica de Jesucristo y como es que lo hacen? ¿Cuales son las pruebas arqueologicas que prueban la veracidad de la Biblia y la historicidad de Jesucristo? ¿Cual es la prueba de que el Dios detuvo al Sol un dia entero para que Josue masacre a una ciudad? ¿Cual es la prueba de que hubo un Diluvio Universal en que Dios aniquilo a todos los seres humanos del planeta? (¡menos a 8!)
    Saludos amigos y no se dejen sorprender por los falsos profetas.
    Walter

  239. qué? says:

    Hey, cojan al ladrón, cojan al ladrón!!!!!!!!!

  240. Eduardo Cruz says:

    “Catch me if you can”
    ja ja ja

  241. Walter says:

    I already caught you phony.

  242. Eduardo Cruz says:

    Vamos, vamos
    Un poco de sentido del humor no hace daño don Walter;
    solo es que con tanto dialogo “acalorado” de pasmosa ingenuidad
    (con respecto al mencionado “ladrón”)
    perdóneme pero vine a recordar el film de
    DreamWorks pictures (2003)
    basado en la novela de Frank William Abagnale Jr.
    llamada
    “Catch me if you can”
    (“atrápame si puedes”)
    con Leo Di Caprio; Tom Hanks y Christopher Walken
    y producida por Steven Spielberg…
    se la recomiendo, es buenísima
    (claro, en gustos se rompen géneros y solo,
    si le gusta el cine como a mi)
    pero en fin es solo una sugerencia,
    si quiere divertirse y relajarse un poco
    pero es solo un comentario.
    Sin embargo esto solo es “irrelevante”
    así como usted considera los títulos universitarios
    por ejemplo de
    “mi Licenciatura”
    y el titulo de Profesor de Filosofía
    de nuestro amigo
    Ricardo “Kimnerkan”
    (quien por cierto le recuerdo que
    estando en dicho foro,
    estamos en “casa ajena”,
    si, si, si, somos bienvenidos como invitados;
    pero finalmente
    es él quien pone las condiciones de su foro,
    no usted como para decirle que “no se auto nombre como tal”)
    ni yo,
    ni nadie,
    en fin…
    Volviendo al tema,
    si usted tiene toda la disposición de tiempo
    para estar solo sentado frente a la computadora
    “Enhorabuena”
    (yo quisiera tenerla también solo que) :
    1- Mis alumnos se gradúan el dia 28 de junio
    y tengo compromisos serios de trabajo,
    2- Mi esposa (y yo) estamos esperando
    (gracias a Dios) y viajo constantemente
    a Estados Unidos por esta razón,
    3- Estoy en medio de una producción grande de trabajo
    4- Tengo un viaje a Guatemala del 4 al 7 de agosto
    y tengo que preparar un material con muchísima pulcritud.
    5- Y finalmente estoy esperando a salir de vacaciones para tener tiempo
    de escribir con la calma que el tema merece en este y otros foros
    Considerare pues sus insultos como algo de
    “falta de paciencia” de su “buena” y finísima persona.
    Y sus referencias a la Biblia y a las palabras atribuidas a Jesucristo
    (quien usted afirma categóricamente nunca haber existido)
    como eso de
    “pongo la otra mejilla,”
    “por sus obras los conoceréis”
    (que por cierto el texto dice:
    por sus “frutos”
    no:
    por sus “obras,” )
    y que por cierto
    yo nunca mencione estas palabras en estos foros,
    sin embargo usted me las atribuye fehacientemente…
    lo considerare pues (como decimos aquí en México):
    se le “chispotio”
    Y si mi “nivel intelectual” no esta a su “altura”
    o si considera verdaderamente tan “irrelevantes”
    mis comentarios
    “Mcdowelianos aborregados”
    bueno, pues;
    no sé por que tanto escándalo con ellos,
    sencillamente
    ¡ignóreme!
    ( ¿no? )
    Si genuinamente mis comentarios no representan nada importante,
    o “un peligro”
    finalmente la gente que los lee NO es tonta
    y puede investigar
    y no solo en la internet (insisto)
    y asi confirmar si verdaderamente lo que yo escribo
    (como usted afirma)
    es solo “mito, mentira, leyenda o no tiene fundamentos historicos”
    Comprenda que no va comprobar nada con ser tan “categórico” en sus afirmaciones
    de que Jesús ( Cristo ) no fue histórico (por ejemplo)
    y tampoco trato yo de recurrir a ningún tipo de falacia de “autoridad” o de “compasión”
    por otro lado, si lo que usted desea es ver escrito en estos foros que
    “usted gano este debate”
    pues
    adelante,
    ¡siéntase el ganador!
    (no tengo problema con eso)
    y publíquelo
    (con bombo y platillo) pues, al final de todos mis comentarios,
    en los diferentes foros donde aparecen sus “contundentes refutaciones” …
    Le envío un cordial saludo y a ver si mas adelante nos reencontramos en algún otro foro
    o en este mismo
    tengo mas información pero no la publicare por ahora,
    ( Mateo 7.6 )
    cuídese y que Dios lo bendiga
    ( aun que usted no crea en él )
    atte. el “fundamentalista” Eduardo Cruz
    PD.
    y conste que cumplí mi promesa de dejar a un lado títulos innecesarios
    (en lo que a mi irrelevante firma concierne)
    y en otras cosas quedamos pendientes
    (solo que sin presiones ok )
    bye.

  243. Walter says:

    Hola Eduardo:
    Lo que no entiendo es como tienes tiempo para escribir cosas personales y no para presentar las pruebas que ofreciste. Si te molestan tanto mis calificativos, me disculpo, lo siento mucho, no tengo nada personal contigo, ni te conozco ni me conoces. Solo se tratan de opiniones que vertimos en el foro y ten la seguridad de que no me molesto para nada, disfruto de los foros, solo es la pasión del debate lo que te parece acaloramiento.
    El asunto de que tengas una Licenciatura o de que Ricardo sea Profesor de Filosofía, no hace mejores ni peores las opiniones que expongan, simplemente no vienen al caso. Las argumentaciones que ustedes presentan deben valer por sí mismas y en todo caso evidenciar sus calificaciones y conocimientos profundizando en el tema que tratamos. El uso de títulos para dar mayor credibilidad a una opinión es lo que se llama “argumento de autoridad” y no se debe usar en un debate. Recuerda que decía Quevedo “las universidades dan diplomas pero no desasnan”, dicho esto anecdóticamente y sin alusiones personales.
    La relevancia de cuestionar los títulos es que al usar ese membrete sorprendes a incautos y, al igual que hace McDowell, contribuyes a ahondar la ignorancia de mucha gente ingenua que ve reforzada su fe al creer falsamente que hay evidencias cuando no las hay. (“Si el Licenciado lo dice debe ser cierto”) Y no es igual que digas, como dijiste antes despectivamente, “Si Walter lo dice…” pues no interesa quien sea yo, mis argumentos valen por sí mismos y pueden estar errados, por ello están expuestos a la refutación de cualquiera que quiera hacerlo, no digo que mis puntos de vista sean correctos porque sea licenciado o doctor, simplemente expongo mis razones.
    La mayoría de tus “evidencias” consisten en citar las opiniones de personajes famosos, ¡nuevamente el argumento de autoridad!, como prueba de la historicidad de Jesucristo. Las opiniones no son pruebas mi amigo, todos podemos equivocarnos, incluso tus personajes celebres. Tambien te podría citar muchas opiniones de ilustres personajes de la historia que te contradigan, pero eso no sería un debate, sería un intercambio de aforismos. Se necesitan evidencias concretas y argumentaciones racionales que cualquiera pueda analizar y entender; no necesitamos que otros nos digan que pensar, si bien debemos documentarnos lo mas que podamos, pero para sacar conclusiones tenemos nuestra propia cabeza. ¿No te parece?
    No se trata de ganar las discusiones, ni de derrotar al oponente, se trata de buscar juntos la verdad y para ello debemos usar argumentos lógicos y presentar evidencias de que nuestros planteamientos son validos. Muchos creyentes terminan diciendo que no necesitan evidencias para creer, y eso esta bien para ellos, pero no esperen que al ingresar a un foro publico para difundir sus creencias los demas se las aceptemos solo porque lo dicen.
    Hasta pronto y buena suerte en todos tus proyectos. Felicitaciones también por el retoño que viene.
    Walter

  244. Eduardo Cruz says:

    Gracias y estoy casi totalmente de acuerdo con usted Walter.
    un saludo a David y a Jun Jan
    atte: Eduardo Cruz.

  245. Eduardo Cruz says:

    Gracias y estoy casi totalmente de acuerdo con usted Walter.
    un saludo a David y a Jun Jan
    atte: Eduardo Cruz.

  246. Eduardo Cruz says:

    Perdón, Jun Jan
    (error de dedo)
    se copio 2 veces
    mi ultimo mensaje,
    también una disculpa por copiar y pegar mi penúltimo comentario en este y en otros foros
    (y por lo tanto obligar a hacer
    lo mismo a Walter)
    PD.
    ya vieron la película?
    es buenísima…
    de verdad!
    y hasta donde se…
    (no lo afirmo categóricamente)
    …basada en un hecho real,
    Se que este comentario ya va muy fuera del tema de este foro.
    (además como lo dije anteriormente:
    “en gustos se rompen géneros”)
    Solo mero entretenimiento para pasar un buen rato de solaz esparcimiento disfrutando (talvez) del buen cine.
    otro “pilón”:
    vieron ya…
    “la vida es bella” ?
    (Italia 1997)
    de Roberto Benigni
    para mi: otra de mis favoritas
    (espero no me veten del foro por salirme del tema)
    es solo una sugerencia para relajar el asunto…
    una pequeña tregua.
    Saludos cordiales también a David
    Eduardo Cruz

  247. MVR1981 says:

    Sepulcro de Confucio – – – – – – Ocupado
    Sepulcro de Buda – – – – – – Ocupado
    Sepulcro de Mahoma – – – – – – Ocupado
    Sepulcro de Jesús – – – – – – VACIO…
    Ok… y donde estan esos sepulcros????.. mejor seria dar el lugar exacto… No???

  248. Walter says:

    A proposito de humor:
    Caminaba por un puente un día y vi a un hombre parado en el borde a punto de saltar, corri hacia él y le dije “¡Detente, no lo hagas!”. ¿Por qué no habría de hacerlo?, me dijo. Le respondi “Bueno, hay mucho por qué vivir”. “¿Como qué?” me dijo. Le dije “¿Bueno, crees en Dios o eres ateo?”. Dijo “Creyente”. Le dije “¡Yo también! ¿Eres cristiano o judio”? “Cristiano”, me dijo. Le dije “¡Yo también!, ¿Eres católico o protestante?”. “Protestante”, dijo. Le dije, “¡Yo también!, ¿Eres episcopaliano o bautista?”. Me dijo “Bautista”. Le dije “¡Guau, yo también! ¿Eres de la Iglesia Bautista de Dios o de la Iglesia Bautista Reformada del Señor?”. Dijo “¡Iglesia Bautista Reformada del Señor!”. Le dije “¡¡Yo también!! ¿Eres de la Iglesia Bautista del Señor Reformada en 1879 o de la Iglesia Bautista del Señor Reformada en 1915?”. Dijo “¡La Iglesia Bautista del Señor Reformada en 1915!”. Le dije “¡Muere basura hereje!, y lo empuje.”
    Emo Philips

  249. Walter says:

    Y un poco mas de humor:
    La Conferencia Episcopal bendice el lanzamiento de Tele Cristo
    La Guerra Santa que enfrenta al gobierno español con la iglesia católica vive un recrudecimiento de las hostilidades. La Conferencia Episcopal ha decidido estrechar el cerco mediático contra los socialistas iniciando de forma ilegal las emisiones del nuevo canal de Televisión de la Conferencia Episcopal: Tele Cristo, con la participación estelar de Jiménez Losantos y el Papa Ratzinger.
    En la misa de presentación, Rouco Varela ha pedido que no se interprete el lanzamiento de la emisora como un acto hostil hacia el gobierno “Es, simplemente, una respuesta al satanismo hertziano de TVE, algunas autonómicas y el grupo PRISA bajo el amparo del PSOE”. Acto seguido, ha celebrado la eucaristía y ha dado detalles de la programación del nuevo canal:
    Dejad que los niños se acerquen a mi. Sin ninguna duda, el programa estrella de la parrilla. Se trata de un show infantil para la franja nocturna presentado por su santidad el Papa Benedicto XVI. Durante más de 2 horas Joseph Ratzinger se rodea de niños y adolescentes a los que introduce en el misterio de la santísima trinidad acariciando el cirio pascual.
    Ojo por ojo, diente por diente. Así se titulará el informativo nocturno de la cadena sagrada. Dirigido por el prestigioso periodista Jiménez Losantos, se presenta como un espacio objetivo y respetuoso. Un espacio donde rojos y catalanes aprenderán a poner la otra mejilla cada vez que reciban las invectivas de ese gran profesional de los medios.
    Rouco Varela, líder de la facción aperturista de la Conferencia Episcopal Española.
    Tele Cepillo. Más que un espacio televisivo, una nueva manera de entender la caridad cristiana. Enviando un SMS premium al 3312 con la palabra Dios, los telefeligreses aportarán dividendos a la causa cristiana.
    Beatificashow. Un reality show al estilo Gran Hermano. 12 almas puras y ejemplares encerradas en un monasterio las 24 horas del día se enfrentarán al veredicto de los telespectadores que elegirán al más santo y beato de los concursantes. El ganador vivirá el martirio en directo que lo elevará a los altares celestiales.
    La Hoguera. Un formato novedoso para una televisión original. Un tribunal de la inquisición presidido por Rouco Varela someterá a un tercer grado a diferentes personajes públicos acusados de herejía. Un verdugo virtuoso interrogará a los invitados para obtener su confesión. Luego se quemarán en la hoguera como en los viejos tiempos. Se están realizando gestiones para que el anticristo Zapatero sea el primer invitado o, en su defecto, Josep Antoni Duran i Lleida.
    Vírgenes del mundo. En coproducción con la revista Playboy, los responsables de Tele Cristo han preparado este producto dirigido al público adulto. A lo largo de 12 capítulos podremos ver a otras tantas mujeres castas que serán tentadas por el diablo a cambio de su virginidad. Veremos lo depravado que puede llegar a ser el demonio.

  250. Pepa says:

    ¡Ufff! Tal como la pintas creo que me engancharé … tiene todos los componentes de un buen “culebrón”.

  251. Walter says:

    Olvide poner el enlace del articulo sobre “TElecristo”
    http://www.mundocruel.com/

  252. me descubrieron! says:

    humor?

  253. Walter says:

    Hola amigos:
    En el blog http://foro-gratis.latin-foros.com/tema-4-0–30-cristianos.html
    aparecio alguien aportando pruebas de la veracidad de la Biblia, en vista de que el buen Eduardo Cruz no aportó ninguna, he aqui lo que dice y tambien mi respuesta:
    De: Daniel Administrador
    Jun 20, 2006 Asunto: NASA Y LA BIBLIA
    Una prueba más de la veracidad de la Biblia encontrada por los científicos del programa espacial de los Estados Unidos.
    Algo muy interesante y asombroso!!
    Para todos los científicos del mundo, y para todos los estudiantes que tienen dificultad para convencer a estas personas de la veracidad de la Biblia, aquí está algo que muestra la asombrosa creación de Dios, y que EL tiene todo bajo control.
    ¿Sabía usted que el programa espacial está muy ocupado probando que lo que fue llamado un “mito” en la Biblia resulta ser verdad?
    El señor Harold Hill, Presidente de la Compañía Curtis Engine en Baltimore, Maryland, y consultante del programa espacial, relata lo que a continuación se desarrolla.
    Pienso que una de las cosas mas maravillosas que Dios ha hecho por nosotros sucedió recientemente a nuestros astronautas y científicos espaciales en Green Belt, Maryland.
    Ellos estaban revisando los cálculos de donde estarían posicionados el sol, la luna, y los planetas dentro de 100 años y dentro de 1000 años. Esta información es necesaria para no enviar un satélite para que choque con algo mas tarde en sus órbitas.
    Tenemos que exponer las órbitas en términos de la vida del satélite y en donde estarán situados los planetas para que el todo del programa no llegue a ser un fracaso.
    Activaron las computadoras con las medidas de ida y de regreso a través de los siglos, pero el programa llegó a un punto donde se detuvo. Cuando la computadora se detuvo apareció una ventana en la pantalla con una señal roja, lo que quiere decir que algo estaba pasando ya sea con la información que se entró en la computadora o con los resultados al momento de ser comparados con los estándares.
    Llamaron al departamento de servicio para revisarlo, y luego preguntaron, ‘¿Qué sucede?’ A lo que respondieron: Bueno, lo que encontraron es que hay un día perdido en el espacio del tiempo.
    Se rascaron la cabeza y se arrancaron el pelo.. No había respuesta.
    Finalmente un hombre cristiano entre ellos dijo, “Un día que fui a la escuela dominical, ellos estaban hablando acerca de que el sol se detuvo”. Mientras ellos no le creyeron, tampoco tenían la respuesta, así que dijeron, “muéstranos”.
    El tomó una Biblia y llegaron al libro de Josué en donde encontraron una declaración bastante ridícula para cualquier persona con “sentido común”.
    Encontraron que el Señor le dijo a Josué, No les tengas miedo, porque los he entregado en tus manos; ninguno de ellos te podrá resistir.
    Josué estaba preocupado porque estaba rodeado por el enemigo! Y si llegaba la noche, ellos serían vencidos. Así que Josué le pidió al Señor hacer que el sol se detuviera! Así es…’El sol se paró y la luna se mantuvo para no bajar por casi un día entero!’
    (Josué 10:12-13)
    Los astronautas y científicos dijeron, Allí está el día perdido! Revisaron las computadoras yendo hacia atrás en el tiempo en que eso fue escrito y encontraron que estaba bastante cerca pero no suficientemente. El tiempo elapsado que estaba perdido en el tiempo de Josué tenía 23 horas y 20 minutos, no un día entero.
    Leyeron la Biblia, y allí estaba “casi un día” (aproximadamente). Estas palabritas en la Biblia son importantes, pero aún no habían resuelto porque no podían figurar donde estaban los 40 minutos que faltaban, lo que les causaría problemas en sus cálculos contando 1000 años desde ahora.
    Tenían que encontrar los 40 minutos para poder multiplicarlo muchas veces sobre sus órbitas. Mientras el empleado cristiano pensaba al respecto, se acordó que en alguna parte de la Biblia decía que el sol se movió HACIA ATRÁS.
    Los científicos le dijeron que estaba loco, pero tomaron el Libro, y leyeron estas palabras en el libro de 2 Reyes que dice la siguiente historia: Ezequías, en su lecho de muerte, fue visitado por el profeta Isaías quien le dijo que no iba a morir. Ezequías le pidió una señal. Isaías le dijo “¿Quieres que el sol avance 10 grados?”
    Ezequías dijo, “No es nada si el sol avanza 10 grados, pero haz que la sombra vaya hacia atrás 10 grados.” Isaías consultó al Señor, y el Señor hizo que la sombra RETROCEDIERA 10 grados! Diez grados es exactamente 40 minutos.
    Veintitres horas y 20 minutos en Josué, más 40 minutos en Segunda de Reyes calza exactamente con el día perdido en el universo! ¿No es eso maravilloso?
    Referencias: Josué 10:8 y 12,13 y 2 Reyes 20:9-11.
    sALudOs
    —————————————-
    De Walter
    Jul 05, 2006 Asunto: “La NASA y la Biblia”
    Daniel:
    Se ha borrado de este blog mi respuesta desenmascarando la evidente mentira propagandística cristiana publicada en el párrafo anterior, con el nombre “NASA y la Biblia” en la que se copia un archiconocido fraude con que los fanáticos religiosos pretenden “probar” que el “sol se detuvo tal como lo dice la Biblia” y que “la NASA lo ha probado”. ¿Es un error? De ser así, a continuación lo envío nuevamente:
    ———————-
    LA NASA, LA BIBLIA Y LAS MENTIRAS
    Para no quitar seriedad a este foro, debías haber visitado la pagina Web del “Centro Espacial Goddard de la NASA” antes de transcribir semejante burrada. Hubieras visto que la NASA desmiente esa trillada trascripción y te hubieras evitado una vergüenza. (Si es que te interesa la verdad, por supuesto)
    http://imagine.gsfc.nasa.gov/docs/ask_astro/answers/970325g.html
    Pero si te quedan dudas de que has patinado feo, transcribo en detalle lo que dice una fuente de la propia apologética cristiana:
    “De tiempo en tiempo aparecen algunas historias como la descrita anteriormente—en boletines de congregaciones y publicaciones religiosas o incluso en el Internet—como factuales y verdaderas. Sin duda aquellos que propagan tal información tienen buenas intenciones, y tienen como su meta final la defensa de la Biblia en contra de las hondas y flechas de la infidelidad. Sin embargo, la historia no es verdadera. La investigación revela los siguientes detalles.
    Muchas historias similares han estado rodeándonos por más de medio siglo. En su libro de 1936, The Harmony of Science and Scripture (La Armonía de la Ciencia y la Escritura), Harry Rimmer dedicó el último capítulo completo a la “Ciencia Moderna y el Día Largo de Josué”. En su tratado, Rimmer relató la historia bíblica de cómo Dios hizo que el Sol se detuviese (Josué 10), y luego hizo el siguiente enunciado acerca de este milagro: “El testimonio final de la ciencia es que tal día dejó su registro para todos los tiempos. Mientras que el tiempo permanezca, el registro de este día debe permanecer. El hecho es atestiguado por hombres eminentes de ciencia, dos de los cuales cito aquí” (1936, p. 280). El Dr. Rimmer luego mencionó a dos científicos—el señor Edwin Ball, un astrónomo británico, y Charles A.L. Totten, un profesor de la Universidad de Yale. Él dio crédito a Ball como siendo el primero en notar que “veinte horas del tiempo solar estaban perdidas”. Rimmer luego hizo las preguntas: “¿Dónde se fueron, cuál fue la causa de este lapso extraño, y cómo pasó?” (p. 280). En el siguiente párrafo, escribió: “Sin embargo, existe un lugar donde la respuesta es encontrada. Y este lugar es autenticado por un científico de estatus. Existe un libro por el Catedrático C.A. Totten de la Universidad de Yale, escrito en 1890, el cual establece el caso sin lugar a dudas” (p. 281). Rimmer luego ofreció lo que el llamó un “resumen” del libro de Totten en el cual, él dijo, puede ser encontrada la información que prueba exactamente cómo el “día perdido” ha sido descubierto. Rimmer incluso dio el día y mes exacto en el cual la batalla de Josué tomó lugar—martes 22 de julio (p. 266).
    Antes de responder a la pregunta acerca del supuesto descubrimiento de los científicos de la NASA del “día perdido” de Josué, déjeme hacer varias observaciones acerca de esta versión antigua (de la cual la versión reciente obviamente ha sido modelada—con adorno considerable). Primero, Rimmer declaró específicamente que él tenía el propósito de “citar de” Ball y Totten, aunque ninguno de los enunciados que él ofreció fue colocado en comillas. Segundo, el libro de 1890 que Totten escribió (Joshua’s Long Day and the Dial of Ahaz—El Día Largo de Josué y el Reloj de Acaz) nunca fue nombrado por Rimmer, lo cual parece un poco extraño considerando que Rimmer dedicó un capítulo completo a este tema en su propio libro. Tercero, ninguna referencia bibliográfica fue provista por Rimmer de las obras de Ball o Totten—otra vez, muy inusual, en vista de cómo Rimmer basó su argumento completo en la validez de sus casos respectivos. Cuarto, otros numerosos escritores han hecho grandes esfuerzos para determinar la validez de las reclamaciones de Rimmer, también como aquellas de Ball y Totten, pero sin ningún éxito. Por ejemplo, Bernard Ramm, en The Christian View of Science and Scripture (El Punto de Vista Cristiano de la Ciencia y la Escritura), trató el punto de vista de Rimmer y su referencia a Totten. Ramm formuló su propia conclusión concerniente a la documentación ofrecida por Rimmer, Totten y Ball en una terminología bien-escogida. Él observó: “Esto no he sido capaz de verificar a mi propia satisfacción… El Dr. Kulp ha tratado de chequear esta teoría en Yale [la organización de Totten—BT] y en Inglaterra [el hogar del señor Edwin Ball—BT] y no ha encontrado nada para verificarlo” (1954, pp. 109,117).
    Sin duda el mismo Rimmer creía que la historia era verdadera. Pero la documentación que debería haber provisto la prueba estaba seriamente y obviamente ausente. El hecho de cómo estas historias se originan es mucho más difícil de averiguar que el hecho de cómo estas se divulgan. Cuando una historia ha sido “corroborada” con lo que parecen ser nombres creíbles y hechos relevantes, la gente a menudo no se molesta en investigarla adicionalmente. Una vez que es aceptada, esta es entonces usada en lo que el creyente en la Biblia ve como una defensa razonable de la Palabra de Dios. De toda la evidencia ahora disponible, la historia de Ball, Totten y Rimmer simplemente no es verdadera y no debería ser usada en la defensa de la Biblia como la Palabra de Dios.
    Lo mismo puede decirse acerca de la versión del tiempo-moderno de la historia. Otra vez, se necesita algún trasfondo histórico. Cuando el relato, como contado por el Dr. Rimmer, fue primero publicado, este causó aparentemente mucho entusiasmo y fue aceptado no críticamente por aquellos que estaban ansiosos de mostrar cómo la ciencia “probaba” que la Biblia era verdadera. Después que el entusiasmo inicial amainó, la historia fue olvidada, o pasada por alto, y finalmente relegada a los montones de reliquias históricas. No obstante, su estadía allí fue breve. Alguien (hasta este día, nadie sabe quién) redescubrió la historia, la “desempolvó”, le dio algo de adorno (sin duda para hacerla más atractiva para la mente científica moderna), proveyó nombres (de individuos, compañías y ciudades) y luego, para que no falte algo, incluyó una referencia a una agencia popular del gobierno que fue, y es, objeto de interés público (la Administración Nacional de Aeronáutica y el Espacio—NASA). Con esta “nueva versión” de la historia ahora completa, ésta llegó a tener una credibilidad inherente que pocos pensaron poner en duda o cuestionar.
    La versión moderna de la historia sugiere que los científicos de la NASA del Centro Espacial de Vuelo de Goddard en Greenbelt, Maryland, estuvieron usando computadoras sofisticadas para trazar las posiciones del Sol, la Luna y otros planetas 100, y 1000, años en el futuro para calcular las trayectorias espaciales. Repentinamente las computadoras pararon. Como resultado, las computadoras habían descubierto un “día perdido” en el tiempo. Los técnicos no supieron cómo arreglar el problema. Pero uno de los científicos presentes había asistido a la escuela dominical cuando era niño, y recordó una historia en la cual Dios hizo que el Sol se parara por alrededor de un día. Cuando él sugirió esto como una posible solución, los otros científicos le ridiculizaron. Sin embargo, el científico abrió la Biblia en Josué 10 y leyó la historia. El técnico entonces introdujo la nueva información en las computadoras (teniendo en cuenta cuidadosamente el “día perdido” de Josué), y las máquinas una vez más zumbaron juntas perfectamente—casi. Las computadoras repentinamente pararon otra vez porque estas no habían descubierto un día completo; algo todavía faltaba. Aparentemente (así continúa la historia) las computadoras solamente encontraron 23 horas y 20 minutos. En otras palabras, 40 minutos todavía faltaban. Pero el científico que fue a la escuela dominical sugirió la respuesta a este enigma. Él recordó 2 Reyes 20, lo cual indica que el Rey Ezequías, habiendo recibido promesa del aplazamiento de su muerte inminente, había requerido una señal del Cielo. Dios entonces hizo que el Sol se moviera hacia atrás diez grados—¡o exactamente 40 minutos! Esta información fue introducida en las computadoras, y estas una vez más trabajaron perfectamente.
    Este cuento llegó a circular extensamente a finales de la década de 1960 y a comienzos de la década de 1970 como resultado de los esfuerzos de Harold Hill, entonces-presidente de la Compañía de Motores de Curtis en Halethorpe (Baltimore), Maryland. En su libro de 1974, How to Live Like a King’s Kid (Cómo Vivir Como un Hijo del Rey), el señor Hill dedicó un capítulo entero a la historia (pp. 65-77) y explicó cómo esto llegó a extenderse tanto. Él declaró que en ocasiones él hablaba a estudiantes de secundaria y universidad concerniente a los temas de la Biblia/Ciencia, y que la historia del “día perdido” de la NASA era una que él “a menudo contaba” (pp. 65-66). De alguna manera (incluso el señor Hill nunca supo cómo), Mary Kathryn Bryan, una columnista del diario Evening World de Spencer, Indiana, recibió un relato escrito de la historia del señor Hill y lo publicó en su columna. Después, Hill anotó, “Varios servicios noticieros recogieron la historia y esta apareció en cientos de lugares” (p. 69, énfasis en original). Sin duda se le proporcionó al relato una cierta cantidad de credibilidad inherente cuando el señor Hill sugirió concerniente al programa espacial en Goddard: “Yo estuve involucrado desde el comienzo, a través de arreglos contractuales con mi compañía” (1974, p. 65). [Sin embargo, la conexión del señor Hill con la NASA era de poca importancia; su compañía tenía un contrato para hacer una revisión de los generadores eléctricos de la agencia del gobierno. Él nunca estuvo conectado en ninguna manera con operaciones de misión o planificación].”
    http://www.apologeticspress.org/espanol/articulos/2781
    Lo que prueba la cita bíblica de “Josué y el largo día”, es que los ignorantes redactores del cuento bíblico creían que el Sol giraba alrededor de la Tierra.
    También demuestra que hay creyentes que están dispuestos a aceptar cualquier cosa que parezca justificar su dogma, sin tener ninguna necesidad de comprobar si la información que manejan es verdadera. La sueltan irresponsablemente y punto.
    Y no es la única mentira fabricada por los fundamentalistas cristianos, hay muchísimas otros fraudes “piadosos” que sirven para consumo de los mas ignorantes de sus feligreses: desde la pintura medieval del Sudario de Turín, que quieren pasar como la mortaja original del mismísimo Jesús; o con el “descubrimiento” del arca de Noe en el monte Ararat; y el descifrado del “Código secreto” de la Biblia; las profecías apocalípticas de los pastorcillos de Fátima, las vírgenes que lloran por tonterías, y los milagros del recién estrenado santo fascista Escriba de Balaguer.
    Y la mentira no es un fenómeno aislado ni casual en la religión, es su único sustento. La aceptación de mentiras como si fueran verdades, la renuncia al razonamiento y a la evaluación de evidencias, el bloqueo de nuestro intelecto cuando se trata de fe, el temor al progreso del pensamiento humano. No tienen pruebas de que sus absurdas creencias sean verdaderas, no las tienen y no las necesitan pues les basta la fe irracional. Y de necesitarlas, no tienen problemas, simplemente las inventan.
    Graficando el uso sistemático de la mentira en la defensa del cristianismo, he aquí lo que decía Martín Lutero:
    “¿Qué daño se haría si un hombre dijera una buena y gran mentira por el bien de lo bueno y de la iglesia cristiana, una mentira por necesidad, una mentira útil? Tales mentiras no irían en contra de Dios; Él las aceptaría”
    ———————-
    Saludos
    Walter
    PD: De no ser un error sino una censura de tu parte eliminando mi respuesta, no hay problema, tienes todo el derecho de hacerlo por ser dueño del blog, pero por lo menos debías también borrar tu articulo con la mentira que motivo mi respuesta. En fin es solo mi humilde opinión :-)
    ============
    Y copio aqui el intercambio por si le interesa a alguien y ademas por si vuelven a borrar mi respuesta del otro blog.
    Saludos a todos,
    Walter

  254. Pop trio Atomic Kitten will reform to play a concert in support of jailed Liverpool football fan Michael Shields…

  255. Pop trio Atomic Kitten will reform to play a concert in support of jailed Liverpool football fan Michael Shields…

  256. Gabriel says:

    No se porque tanto discutir, quien es mas tonto, el tonto que hizo una critica que es aceptable en nivel primaria de torpe-analfabeta, o los que le contestan?
    Este niño no sabe lo que es libertad de expresion, seguno ni ha leido las leyes vigentes.
    Primero menciona “libertad de expresión” y “democracia” pasaron sin dejar huella
    segun “junjan” que hace una critica u observacion de esta nota, no sabe que estaba escribiendo ni sabe lo que significa, ni sabe lo que es democracia, y ni siquiera conoce su historia de la democracia, siendo que hay material de sobra historica y real y segun él, defiende solos los hechos materiales historicos comprobables y no los imaginables.
    Si asi fuera el solo se daria la razon , pero como se nota que no lee un libro y ni tiene una vida, escribe cualquier disparate que se le ocurre.
    (EStudia algo de historia griega o filosofia.)
    Si no lo sabias Los que dieron nacimiento a la democracia y valores civiles que hasta el dia de hoy y siguen vigentes y basados en esos conceptos algunos paises hacen sus leyes. fueron personas como Aristoteles, Aruimides, Platon, etc.
    juzgaban la exitencia de dios o dioses, pero aun asi los invocaban, estas personas tenian creencias,
    A pesar de eso crearon los conceptos que tu estas defendiendo.
    si quieres defender a personas sus hechos, y los factores que marcaron sus vidas deberas defender sus conceptos y creencias tambien, porque esas creencias susgieron esas “ideas” que se transformaron en “conceptos”
    Si no defiendes ambas partes estas cayendo en otro disparate.
    Deberas defender a lo que estos personajes llamaron democaracia “democaracia” y el porque lo crearon que serian sus “creencias”
    (“Vamos a hablar sobre hechos reales, que es lo que tanto peleas”)
    Como hitler fue real e historico, su SS no es mas que un “simbolo”, que quizas no tendra valor para ti, o para mi, pero Hitler murio por ello.
    Si estuvieras en tiempo de guerra, te hubieras cagado en la bandera de hitler? o te hubieras atrevido a decirselo a un soldado de la SS?, por su puesto que no ( a menos que se sea lo bastante estupido para hacerlo), Si tiene valor para ti harias lo que un soldado de la SS, matar a quien lo dijo, pero si no tiene valor para ti, te expresarias?, es lo que tanto pregonas y defiendes? no hacer caso a sombolos o creencias?
    Que para alguien no tengan valor “algo”, no significa que para otras no lo tenga.
    Para Hitler le estas ofendiendo su “simbolo” su porque, asi como el tipo que hizo “Me cago en Dios” Ofende a la creencia o “simbolo de fé” de estas gentes.
    Hitler te estaria metiendo unos kilos de plomo en tu cabeza, las personas que acudieron a la obra solo destruyeron el escenario.
    El dia que tu leas un poco sabras de lo que te estoy escribiendo.
    No seas tan ignorante, porque el dia que te metas en lios y llegues a la corte o poder judicual “te va a comer vivo”, no sabes lo que dices, disparate tras disparate, en pocas palabras no te sabes defender, derechito a la carcel
    (definitivamente si logras hacer una carrera , que no sea de abogado,jeje, te vas a morir de hambre)
    y cuadno termines de estudiar te daras cuenta del ridiculo IQ que tienes, y de lo poco que puedes ofrecer a esta sociedad, mejor antes de dar una opinion, estudia e investiga sobre lo que quieres opinar.
    Para que sea una opinion inteligente, y no una opinion como la que hiciste respecto a la nota, opinion totalmente estupida sin argumentos, discriminatoria y racista.

  257. Gabriel says:

    No se porque tanto discutir, quien es mas tonto, el tonto que hizo una critica que es aceptable en nivel primaria de torpe-analfabeta, o los que le contestan?
    Este niño no sabe lo que es libertad de expresion, seguno ni ha leido las leyes vigentes.
    Primero menciona “libertad de expresión” y “democracia” pasaron sin dejar huella
    segun “junjan” que hace una critica u observacion de esta nota, no sabe que estaba escribiendo ni sabe lo que significa, ni sabe lo que es democracia, y ni siquiera conoce su historia de la democracia, siendo que hay material de sobra historica y real y segun él, defiende solos los hechos materiales historicos comprobables y no los imaginables.
    Si asi fuera el solo se daria la razon , pero como se nota que no lee un libro y ni tiene una vida, escribe cualquier disparate que se le ocurre.
    (EStudia algo de historia griega o filosofia.)
    Si no lo sabias Los que dieron nacimiento a la democracia y valores civiles que hasta el dia de hoy y siguen vigentes y basados en esos conceptos algunos paises hacen sus leyes. fueron personas como Aristoteles, Aruimides, Platon, etc.
    juzgaban la exitencia de dios o dioses, pero aun asi los invocaban, estas personas tenian creencias,
    A pesar de eso crearon los conceptos que tu estas defendiendo.
    si quieres defender a personas sus hechos, y los factores que marcaron sus vidas deberas defender sus conceptos y creencias tambien, porque esas creencias susgieron esas “ideas” que se transformaron en “conceptos”
    Si no defiendes ambas partes estas cayendo en otro disparate.
    Deberas defender a lo que estos personajes llamaron democaracia “democaracia” y el porque lo crearon que serian sus “creencias”
    (“Vamos a hablar sobre hechos reales, que es lo que tanto peleas”)
    Como hitler fue real e historico, su SS no es mas que un “simbolo”, que quizas no tendra valor para ti, o para mi, pero Hitler murio por ello.
    Si estuvieras en tiempo de guerra, te hubieras cagado en la bandera de hitler? o te hubieras atrevido a decirselo a un soldado de la SS?, por su puesto que no ( a menos que se sea lo bastante estupido para hacerlo), Si tiene valor para ti harias lo que un soldado de la SS, matar a quien lo dijo, pero si no tiene valor para ti, te expresarias?, es lo que tanto pregonas y defiendes? no hacer caso a sombolos o creencias?
    Que para alguien no tengan valor “algo”, no significa que para otras no lo tenga.
    Para Hitler le estas ofendiendo su “simbolo” su porque, asi como el tipo que hizo “Me cago en Dios” Ofende a la creencia o “simbolo de fé” de estas gentes.
    Hitler te estaria metiendo unos kilos de plomo en tu cabeza, las personas que acudieron a la obra solo destruyeron el escenario.
    El dia que tu leas un poco sabras de lo que te estoy escribiendo.
    No seas tan ignorante, porque el dia que te metas en lios y llegues a la corte o poder judicual “te va a comer vivo”, no sabes lo que dices, disparate tras disparate, en pocas palabras no te sabes defender, derechito a la carcel
    (definitivamente si logras hacer una carrera , que no sea de abogado,jeje, te vas a morir de hambre)
    y cuadno termines de estudiar te daras cuenta del ridiculo IQ que tienes, y de lo poco que puedes ofrecer a esta sociedad, mejor antes de dar una opinion, estudia e investiga sobre lo que quieres opinar.
    Para que sea una opinion inteligente, y no una opinion como la que hiciste respecto a la nota, opinion totalmente estupida sin argumentos, discriminatoria y racista.

  258. Gabriel says:

    No se porque tanto discutir, quien es mas tonto, el tonto que hizo una critica que es aceptable en nivel primaria de torpe-analfabeta, o los que le contestan?
    Este niño no sabe lo que es libertad de expresion, seguno ni ha leido las leyes vigentes.
    Primero menciona “libertad de expresión” y “democracia” pasaron sin dejar huella
    segun “junjan” que hace una critica u observacion de esta nota, no sabe que estaba escribiendo ni sabe lo que significa, ni sabe lo que es democracia, y ni siquiera conoce su historia de la democracia, siendo que hay material de sobra historica y real y segun él, defiende solos los hechos materiales historicos comprobables y no los imaginables.
    Si asi fuera el solo se daria la razon , pero como se nota que no lee un libro y ni tiene una vida, escribe cualquier disparate que se le ocurre.
    (EStudia algo de historia griega o filosofia.)
    Si no lo sabias Los que dieron nacimiento a la democracia y valores civiles que hasta el dia de hoy y siguen vigentes y basados en esos conceptos algunos paises hacen sus leyes. fueron personas como Aristoteles, Aruimides, Platon, etc.
    juzgaban la exitencia de dios o dioses, pero aun asi los invocaban, estas personas tenian creencias,
    A pesar de eso crearon los conceptos que tu estas defendiendo.
    si quieres defender a personas sus hechos, y los factores que marcaron sus vidas deberas defender sus conceptos y creencias tambien, porque esas creencias susgieron esas “ideas” que se transformaron en “conceptos”
    Si no defiendes ambas partes estas cayendo en otro disparate.
    Deberas defender a lo que estos personajes llamaron democaracia “democaracia” y el porque lo crearon que serian sus “creencias”
    (“Vamos a hablar sobre hechos reales, que es lo que tanto peleas”)
    Como hitler fue real e historico, su SS no es mas que un “simbolo”, que quizas no tendra valor para ti, o para mi, pero Hitler murio por ello.
    Si estuvieras en tiempo de guerra, te hubieras cagado en la bandera de hitler? o te hubieras atrevido a decirselo a un soldado de la SS?, por su puesto que no ( a menos que se sea lo bastante estupido para hacerlo), Si tiene valor para ti harias lo que un soldado de la SS, matar a quien lo dijo, pero si no tiene valor para ti, te expresarias?, es lo que tanto pregonas y defiendes? no hacer caso a sombolos o creencias?
    Que para alguien no tengan valor “algo”, no significa que para otras no lo tenga.
    Para Hitler le estas ofendiendo su “simbolo” su porque, asi como el tipo que hizo “Me cago en Dios” Ofende a la creencia o “simbolo de fé” de estas gentes.
    Hitler te estaria metiendo unos kilos de plomo en tu cabeza, las personas que acudieron a la obra solo destruyeron el escenario.
    El dia que tu leas un poco sabras de lo que te estoy escribiendo.
    No seas tan ignorante, porque el dia que te metas en lios y llegues a la corte o poder judicual “te va a comer vivo”, no sabes lo que dices, disparate tras disparate, en pocas palabras no te sabes defender, derechito a la carcel
    (definitivamente si logras hacer una carrera , que no sea de abogado,jeje, te vas a morir de hambre)
    y cuadno termines de estudiar te daras cuenta del ridiculo IQ que tienes, y de lo poco que puedes ofrecer a esta sociedad, mejor antes de dar una opinion, estudia e investiga sobre lo que quieres opinar.
    Para que sea una opinion inteligente, y no una opinion como la que hiciste respecto a la nota, opinion totalmente estupida sin argumentos, discriminatoria y racista.

  259. fernando says:

    +
    Viva Cristo Rey. Cristo reinará, contigo o sin tí… Mejor que sea contigo

  260. Ricardo says:

    pero cristo nosotros mismos le dimos muerte. seria muy hipocrita que alabemos a quien hemos dado muerte.

  261. Harry.cia.ltda says:

    de la web http://personal.telefonica.terra.es/web/fir/llibres/jesus.html
    El Libro expone la posibilidad de que Jesús no muriera en la Cruz, sino que una vez curado de las heridas causadas por la cruzifixión, emprendiera la huida hacia el Este, en busca de las tribus perdidas de Israel. Jesús habría llegado así a Cachemira, en donde comenzaría una nueva vida y moriría —a edad muy avanzada— de muerte natural. Su tumba se venera hoy en Srinagar, capital de Cachemira.
    Además de la tumba própiamente dicha, una serie de nombres toponímicos dan fe en Cachemira del paso de jesús.
    Por otra parte, en Pakistán y a escasos kilómetros de la frontera con Cachemira, se ha localizado la tumba de María, madre de jesús, quien le habría acompañado en su huida hacia el Este. No soportando las penalidades del viaje, habría muerto en el camino, ya muy cerca del punto de destino.
    Existen testimonios que hacen suponer que jesús eligió este lugar para emprender la segunda etapa de su vida, por cuanto ya habría estado aquí durante los años en que la historia occidental no puede dar fe de sus actividades. Pero sí pueden darla, en cambio, textos históricos localizados en la lamasería tibetana de Lhasa y en la lamasería Hemis, en Ladakh (Cachemira).
    Además de las tumbas de Jesús y María, una reducida comunidad judía aislada en la montaña viene custodiando en Cachemira, desde hace 3500 años, la tumba de Moisés, del que igualmente hablan nombres toponímicos, conservándose incluso, allí, la llamada “piedra de Moisés”.
    Andreas Faber-Kaiser y Mercedes Castellanos viajaron al norte de la India para recoger testimonios y documentación sobre el terreno, para verterla luego en este libro que dió a conocer a Occidente etsa tradición de la vida secreta de jesús.
    Libro polémico desde un pricipio, Jesús vivió y murió en Cachemira levantó ampollas en los sectores religiosos de la sociedad española de la transición. A la rápida difusión de las primeras ediciones que catapultó el libro a las listas de best-sellers españoles se sumó un eco ámplio del tema en los medios de comunicación, con discusiones del mismo en canales de TV, en espacios radiofónicos y en publicaciones periódicas de varios paises. Un conocido rotativo francés eligió la publicación del libro como muestra de la apertura que se estaba operando en una España que comenzaba a intentar acceder a la democracia. También se sucedieron las conferencias, y el estudio mereció ser traducido mientras tanto a siete idiomas, y basados en el mismo han aparecido ya diferentes libros de distintos autores, amén de numerosos artículos en publicaciones que van desde los Estados Unidos hasta Australia.
    Muy activos se mostraron en su momento y en sus ataques al libro determinados representantes de la comunidad evangélica, que en un intento fulgurante de evitar que alguna de sus ovejas pudiera caer en la tentación de pensar por sí misma, le mascaron solícitamente el alimento del refuerzo de su fé en oportunas y, ¡cómo no!, insultantes conferencias, precedidas por la correspondiente publicidad callejera. Cabe recordar que el mismo cardenal Gracias Valerian manifestó públicamente su miedo a que se publicaran estos datos. Alguien quiso incluso frenar la publicación del libro amenazando con la excomunión de su autor; otros —muchos— están empeñadaos en saber de buena tinta que Andreas Faber-Kaiser es musulmán, que el libro está patrocinado por los ahmadíyyas, y otras gratuidades por el estilo. Pero como el fanatismo no calcula, todo ello no contribuyó sino a popularizar aun más el libro.

  262. Walter says:

    Jesús y los cuentos cachemiros
    Comencemos, pues, con el contenido del texto que nos ocupa. El primer capítulo titulado “Un viaje, un comienzo” nos da ya una primera pista de por dónde va a ir el autor, una extraña mezcolanza entre misterios relacionados con Jesús y órdenes iniciáticas secretas (dos temas para comenzar a temblar, obviamente).
    También nos ofrece la palpable demostración de su método de trabajo que consiste en creerse lo que alguien haya dicho antes de él sin preocuparse demasiado de comprobar si esas afirmaciones son ciertas o si ya se han demostrado como falsas.
    Veamos la plasmación de ambas cuestiones. Va a Cachemira guiado por una obra de Andreas Faber-Kaiser, “Jesús vivió y murió en Cachemira” Ed. A.T.E. Barcelona, 1976 que, a su vez, sigue el relato del periodista ruso, explorador y tal vez espía, Nicolai Notovitch, pero, como suele suceder, Faber-Kaiser va mucho más lejos de lo que aseguró éste. Comencemos pues por deslindar qué pertenece a uno y a otro.
    Nicolai Notovitch publicó en francés “La vie incconue de Jesús-Christ en Inde et au Tibet” (Ed. Ollendorf. París, 1894) que obtuvo un gran éxito con diversas reediciones y traducciones a otra lenguas (en español, en 1909). La historia que cuenta es sencilla.
    Estando él de viaje por el Tíbet escuchó hablar en la lamasería de Moulbek de un profeta llamado Issa. Conversando con el lama principal de la lamasería de Hemis éste le confirma la historia y le asegura que en su monasterio se encontraban diversos textos que hablaban de él y que eran copias en tibetano de los originales escritos en pali que se encontraban en Lhasa. Añade que el profeta Issa había predicado en la India y a los hijos de Israel y que era muy apreciado entre los lamas importantes pese a que sus seguidores, los cristianos, no reconocían la autoridad del Dalai Lama. Notovitch solicita le enseñen dichos escritos, pero el lama dice desconocer dónde se encuentran, pero que si tiene ocasión de regresar a la lamasería, los tendrá preparados para mostrárselos.
    Dos días después, Notovitch envía al lama un reloj y un termómetro como regalo y le anuncia una nueva visita que será más larga de lo que imaginaba porque sufre una caída del caballo y se rompe una pierna. Mientras espera su curación, se hospeda en la lamasería de Hemis dónde, por fin, el lama le lee mientras un intérprete le traduce dos gruesos rollos que contienen “La vida de Issa”. Siempre según el ruso, en esos textos se aseguraba que Issa nació en el país de Israel en una familia bendecida por Dios a causa de su fidelidad. A los trece años Issa debía contraer matrimonio. Para escapar de esa obligación abandona su hogar y se dirige a Sindh para conocer las leyes de los grandes Budas. Es instruido en las doctrinas del hinduismo en Jagannath, Rajagriha y Benarés pero su prédica igualitaria y monoteísta entra en contradicción con las castas de los Brahmanes (sacerdotes) y los Kshatriyas (guerreros) por lo que debe huir, para salvar su vida, a las montañas del Himalaya dónde estudiará los textos religiosos del budismo.
    Finalmente, considerando que ya estaba suficientemente formado, regresa a su hogar pasando por Persia en donde discutirá con los sacerdotes de Zoroastro atacando su dualismo y asegurando que sólo existe un Dios del bien. Los sacerdotes le apresan y le abandonan extramuros para que sea comido por las fieras, pero Issa no sufre ningún daño y regresa a su hogar cuando tenía 29 años. Cuatro años más tarde fue ejecutado por los romanos por decisión de Poncio Pilato pese a que los judíos no vieron en él ninguna falta. Después de su muerte, sus discípulos llevaron su doctrina por todo el mundo, son los cristianos.
    Como vemos, el texto de Notovitch sólo pretende rellenar los llamados “años oscuros” de Jesús, es decir, la laguna que existe en los relatos evangélicos desde el episodio de Jesús perdido y hallado en el Templo de Jerusalén hasta el comienzo de su vida pública. Por lo demás, el texto se atiene a los evangelios (Issa muere ejecutado por los romanos, sus discípulos aseguran que resucita…). Una pequeña diferencia, claro, es que “La vida de Issa” tibetana exculpa a los judíos de cualquier participación en la ejecución. Luego veremos cómo este pequeño detalle tiene su importancia.
    El de Faber-Kaiser es completamente distinto. Acepta la primera parte de la historia, el primer viaje de Jesús-Issa a la India pero, según él, Jesús aunque fue crucificado no murió. Su resurrección fue una mera recuperación de sus heridas. Una vez sanado, se trasladó a Cachemira donde se casó, tuvo hijos que iniciaron una descendencia que llega hasta hoy, murió y fue enterrado en una tuma que todavía hoy se conserva en Srinagar. La razón para esta diferencia es una serie de informaciones transmitidas por el profesor Hassnain.
    Bien hasta aquí todo lo que acepta el Sr. Fernández Bueno en su obra. ¿Qué hay de cierto en ello? Voy a sorprenderles. Nada ¿a que no se lo esperaban?
    Por de pronto, el método de trabajo de Notovitch indica que éste no podía saber si el lama, el traductor o ambos le estaban “tomando el pelo”. No tenía forma de verificar si le estaban diciendo la verdad o le estaban mintiendo. No obstante, la verdad es aún peor que una broma de dudoso gusto aunque con notables antecedentes como sabe cualquier antropólogo.
    Cuando Notovitch publicó su libro, fue objeto de la atención del profesor Friedrich Max Müller, uno de los grandes orientalistas de la época. Su dictamen fue que era falso. Las razones del profesor Müller fueron dos, la primera de orden externo y la segunda de incoherencia interna. Supuestamente Notovitch había tenido acceso a un texto tibetano titulado “La vida de Issa”. En las recopilaciones de obras tibetanas llamadas Tandjur y Kandjur no existe la menor noticia de un escrito con ese título. Por otra parte, supongamos que la historia de Notovitch sea cierta. ¿Cómo llegaron al Tíbet las noticias de la muerte de Issa-Jesús? Supuestamente llevada por mercaderes judíos, pero entonces ¿quién identificó a Jesús como la misma persona que había estudiado en la India y el Tíbet? Misterio de los misterios.
    No se quiebren demasiado la cabeza buscando respuesta. Müller también indicó que había recibido una carta de una corresponsal inglesa que había preguntado por un ruso apellidado Notovitch en la lamasería de Hemis y que allí nadie le conocía.
    Por si fuera poco, Archibald Douglas decidió comprobar la historia de Notovitch así que acudió a la lamasería de Hemis y habló con el mismo lama que, supuestamente, conversó con el ruso. El lama negó que conociera a Notovitch, que hubieran atendido a ningún occidental con una pierna rota, que existieran los dos rollos con “La vida de Issa” en su monasterio, que existiera ninguna tradición tibetana sobre Issa-Jesús del que sólo sabían lo que decían los misioneros, que nadie le hubiera regalado un termómetro (ni siquiera sabía qué era)… La única prueba que pudo conseguir Archibald Douglas de que Notovitch siquiera habiera estado realmente en el Tíbet es que un viajero con ese nombre fue atendido de dolor de muelas en Leh.
    No obstante, la imparcialidad nos obliga a ser cautos tanto con unas afirmaciones como con otras. No obstante, algo si nos permite dilucidar quién decía la verdad y quién no. En el prefacio a la edición inglesa de su libro (1895) Notovitch cambió su historia. Los dos rollos ya no existían como tampoco “La vida de Issa”. En realidad, él había compuesto su texto tomando diversos fragmentos de obras del monasterio de Hemis ordenándolos como mejor le pareció. Esto explicaba porqué no aparecía esta obra en el Tandjur y el Kandjur. Con relación a que negaran conocerle y que existieran dichas menciones a Issa en la lamasería de Hemis, Notovitch aseguró más tarde que era por miedo a que los occidentales robaran los textos.
    Bueno, puede parecer extraño pero posible lo es. No obstante, los errores del texto no pueden ser explicados por lo antedicho. Por ejemplo, “La vida de Issa” habla del Dios de los jainitas, pero esa noción es ajena al jainismo. El original de “La vida de Issa” supuestamente había sido introducido en el Tíbet escrito en pali, pero ese idioma no ha sido nunca empleado en los libros budistas tibetanos. Ítem más, los budistas tibetanos no pudieron ser nunca informados de la vida de Issa-Jesús por testigos presenciales porque el budismo no se difunde en el Tíbet hasta 700 años después de la vida de Jesús. Más aún, el texto de Notovitch presenta a Jesús viviendo en el templo de Jagganath… que fue construido mil años más tarde (si pensaban que el error de J. J. Benítez al decir que Jesús había estado en el Coliseo de Roma era insuperable, ya ven…)
    Por si todo ello fuera poco, cuando la obra de Notovitch tuvo una reedición en la década de 1920 en los EEUU fue estudiada por Edgard J. Goodspeld que encontró paralelismos entre el estilo de “La vida de Issa” y los evangelios de Mateo, Lucas, Hechos y la Carta a los Romanos.
    La conclusión está clara. “La vida de Issa” es una falsificación. Así las cosas, podemos preguntarnos ¿Por qué? Cuestiones económicas aparte, ya dijimos que “La vida de Issa” según Notovitch exculpaba completamente a los judíos de la muerte de Jesús. Notovitch era judío aunque se había convertido al cristianismo ortodoxo. En estos años se produce un repunte del antisemitismo en su Rusia natal a raíz del asesinato del zar Alejandro II en 1881. ¿Fue ésta la razón? ¿Tuvo algo que ver la suposición de Madame Blavatsky en su “Isis sin velo” de que Jesús podía haber viajado al Himalaya dado que encontraba paralelismos entre el cristianismo y el budismo? Nunca lo sabremos.
    Por contra, las fuentes de Andreas Faber-Kaiser son mucho más claras en cuanto a su motivación. Resumiendo la cuestión, su fuente es una secta musulmana, el movimiento ahmadiyya fundado por Mirza Ghulam Ahmad. Este curioso personaje no tuvo el menor empacho en presentarse como el Mahdi esperado por los musulmanes, el Mesías esperado por los judíos… en un ecumenismo “traído por los pelos”. Obviamente, para cumplir con su misión tenía que superar el obstáculo de la creencia en que ya no había que esperar nuevos Mesías porque con Jesús ya se había cumplido la esperanza mesiánica hasta su segunda venida que supondrá el Fin del Mundo. Para ello no vaciló en presentarse como reencarnación de Jesús así como negar que hubiera existido resurrección y ascensión al cielo (por un motivo obvio, si Jesús estuviera en el cielo en carne y hueso no podía reencarnarse puesto que no estaba descarnado). De este confuso batiburrillo doctrinal surgieron sus afirmaciones sobre la supervivencia de Jesús, su viaje a la India… aprovechando algunas viejas leyendas (sin base histórica alguna) árabes y nestorianas sobre estos temas. Vamos, que creerse esas historias sobre la tumba de Jesús en Srinagar supone un ejercicio de fe no menor que el se precisa para aceptar que Santiago está enterrado en Compostela o que el Grial está en la catedral de Valencia.
    Pero si esto es así, ¿cómo se explica que algunas personas a lo largo de los años hayan declarado haber encontrado en monasterios tibetanos textos referentes a Issa? Bueno, primero hay que diferenciar si realmente aseguraron haberlos visto o si sus declaraciones son del tipo “Conozco a alguien que tenía un primo segundo que era abuelo de Fulanito que en la lamasería de…” Muy pocas pertenecen al primer grupo. De los que sí dicen tal cosa, habría que ver lo que transcriben porque en más de un caso aseguran haber leído lo que Notovitch escribió en su libro ignorando que el ruso, como ya dijimos, reconoció que había unido fragmentos de diversas obras por lo que si lo creemos (y si no lo creemos nos quedamos sin historia de Issa) nadie puede encontrar una única obra que corresponda a lo que Notovitch redactó. Si de los tres o cuatro que quedan eliminamos a las personas interesadas bien por su relación con la secta ahmadiyya bien porque escribieran libros sobre el tema, nos quedamos sin nadie.
    La verdad es que nadie, absolutamente nadie, ha sido capaz de proporcionar pruebas de que dichos textos existan como tampoco de que Jesús anduviera por esas tierras ni, mucho menos, de que esté enterrado en Srinagar (también se encuentran en Cachemira las tumbas de Moisés y María con lo que parece que la inventiva de los paisanos para crear enterramientos famosos supera a la de los nativos de Colonia en cuya catedral están enterrados, ni más ni menos, que los Reyes Magos).
    De Crítica de libros ‘Los guardianes del secreto’
    http://www.circuloesceptico.org/Documentos/

  263. EDUARDO VITAL says:

    SÓLO PUEDO DECIR ANTE TANTA ESTÚPIDEZ QUE MANIFIESTAS ¡¡¡VIVA CRISTO REY Y SANTA MARÍA DE GUADALUPE!!!
    EDUARDO VITAL
    CIUDAD DE MÉJICO.

  264. Martha says:

    Pues sí. ¡SI! Era solo cuestión de tiempo….
    ¡VIVA CRISTO REY!

  265. fram says:

    El respeto a los demas es lo que diferencia a humanos de animales. Si no respetamos a las idelogias y creencias no podemos esperar aplausos, lo unico que podemos esperar es ira. Ante una provocación permitida por todo organismo que se hace llamar democratico veo totalmente justificada tal reacción.

  266. arriba españa!! says:

    ARRIBA ESPAÑA!!!VIVA FRANCO
    rojos,no gracias

  267. Como todos ustedes piensan, el si existe o no Diós es cuestión personal y cada uno es responsable de decirse a sí mismo cua es su opinión. Aunque creo -como junjuan, ¿o fue walter?- que la religión sólo amarra a la gente.
    Adiós!

  268. adriano says:

    Increible que aun se traté de denigrar a la religión y la moral, que son democreticamente una gran mayoria en algunos paises, ademàs de una ideologia orientada al bien común, por lo tanto como es posible que se exponga una falacia tan carente de creatividad como “me cago…” ¿es que no les alcansa la imaginación para crear algo vueno y agradable para el público?

  269. venenito says:

    lastima que no tengo tanto tiempo de leer todos los comentarios, pero el junjan este salto mal con el corleone ehhh, mmmm eso me resulto sospechoso y despues pepa, muy bien lo tuyo eh, pero ideologizada con lols progres del pasado, y que la apologia del nazismo es delito en europa, bueno serà porque ganaron los judios, no?? jajaj
    lo importante ((mira ya me olvide de que se trataban las discusiones aca))) decia, lo importante es la libertad de opinion, y uno puede cagarse en quien quiera pero de forma no ofensiva, asi que dios existe o no me tiene sin cuidado, uno por ahi nombro no se qque dando como fecha aparente de creacion del mundo el año cero , parece que fue jesus el que invento el mundo en fin…. bueno sigo leyendo cuando tenga tiempo.-

  270. Soy YO quien Lee no mas says:

    Junjan eres un pendejo que se las cree saber de todas todas.
    En resumen solo eres un morboso lector

  271. el apologista says:

    sabes juan juan heres un ignorante, humanista, ciego y desnudo, porque sigues pensamientos y filosofias de hombres inperfectos. que no te dan respuesta ni esperanza sobre la vida,que mas te traen conjucion y desperacion. en ves de seguir esos pensamientos de hombres porque no sigues los pensamientos de jesucristo dios hecho hombre. que te da esperanza y paz, y respuestas a muchas preguntas. tonto no sabes que mañana te puedes morir ¿quien te salvara? ¿tu crees que la vida se termina para siempre con la muerte? .

  272. Anónima de las 3:21. says:

    Walter:
    Muchas gracias, realmente has aportado mucha luz a este tema…

  273. Antonio Inda says:

    Tiene que haber respeto entre las personas nose puede jugar con la fe, nose puede usar la libertad de expresion para hacer ese tipo de actos contra dios “Viva Cristo Rey”.

  274. carlos giovanni marcelo roberto says:

    Bueno, yo soy catolico, y el titulo de la obra no solo ofonde nuestro credo y FE, si yo estoy en los zapatos que estoy COMO CRISTIANO le caigo a patadas y todo lo que tenga en mis manos al imbecil autor de ESA OBRA y me cagaria no solo en el sino en su maldita estirpe que no le ensen~o NUNCA a repetar a DIOS. AMEN!!!
    Pues dijo el SENOR: Äquel que se averguence de mi delante de los hombres, YO me avergonzare de el, delante de mi PADRE Celestial” PALABRA DE DIOS!!!

  275. Nicolás says:

    Gloria a Ti Señor Jesus

  276. Nicolás says:

    Francisco Franco: Presente
    Caidos por Dios y por España: Presentes
    Viva Cristo Rey

  277. Luis Rodriguez says:

    Tácito, nacido hacia el 55 E.C. y considerado uno de los mejores historiadores del mundo, mencionó a los cristianos en su obra Anales. En el relato acerca de la ocasión en que Nerón acusó a los cristianos del gran incendio de Roma del año 64 E.C., escribió: “Nerón presentó como culpables y sometió a los más rebuscados tormentos a los que el vulgo llamaba cristianos, aborrecidos por sus ignomi[ni]as. Aquel de quien tomaban nombre, Cristo, había sido ejecutado en el reinado de Tiberio por el procurador Poncio Pilato”. Los detalles de este relato corresponden a la información acerca del Jesús de la Biblia.
    Por ejemplo, analicemos el testimonio de Flavio Josefo, fariseo e historiador judío del siglo primero, que se refirió a Jesucristo en su obra Antigüedades Judías. Aunque algunos dudan de la autenticidad de la primera referencia, en la que Josefo dice que Jesús es el Mesías, el profesor Louis H. Feldman, de la Universidad Yeshiva, dice que pocos han dudado de la veracidad de la segunda referencia, en la que Josefo afirmó: “[Anán, el sumo sacerdote] reunió el sanedrín. Llamó a juicio al hermano de Jesús que se llamó Cristo; su nombre era Jacobo [o Santiago]” (Antigüedades Judías, libro XX, cap. IX, sec. 1, [200]). Sí, un fariseo, un miembro de esa secta repleta de enemigos declarados de Jesús, reconoció la existencia de Santiago, “hermano de Jesús”.
    Otro escritor que hizo comentarios respecto a los seguidores de Jesús fue Plinio el Joven, el gobernador de Bitinia. Cerca del año 111 E.C., Plinio escribió al emperador Trajano para preguntarle cómo tratar con los cristianos, y le señaló que los acusados falsamente de ser cristianos demostraban que no lo eran al repetir una invocación a los dioses y adorar la estatua de Trajano, “cosas todas que”, según indicó Plinio, era “imposible forzar a hacer a los que son de verdad cristianos”. Esto da testimonio de que Cristo realmente existió y de que sus seguidores estaban dispuestos a sacrificar su vida por creer en él.Después de resumir las referencias a Jesucristo y sus discípulos por parte de historiadores de los primeros dos siglos, The Encyclopædia Britannica (edición de 2002) concluye: “Estos relatos independientes demuestran que en la antigüedad ni siquiera los opositores del cristianismo dudaron de la historicidad de Jesús, que comenzó a ponerse en tela de juicio, sin base alguna, a finales del siglo XVIII, a lo largo del XIX y a principios del XX”.

  278. Walter says:

    Hola Luis:
    Aqui te paso lo que se publicó hace tiempo en una página vecina de este mismo foro:
    ———– Flavio Josefo y el Testimonio Flaviano
    Entre los ejemplos más flagrantes de la deshonestidad básica de McDowell con la evidencia, está la forma como trata el Testimonio Flaviano, la cita de Flavio Josefo acerca de Jesús en “Antiguedades de los Judíos”, escrito en la segunda mitad del siglo primero. McDowell dice que la cita es “altamente controversial”, pero nunca nos dice que quiere decir con eso y entonces empieza a tratar la cita como si fuera auténtica. Lo que significa “Altamente controversial” (aunque yo lo diría de forma diferente) es que la gran mayoría de los eruditos desde los inicios de 1800 han dicho que esta cita no fue escrita por Josefo, sino que es una inserción Cristiana tardía en sus trabajos. En otras palabras, es un Fraude, rechazado por los académicos. Por supuesto, eso no preocupa a McDowell, quien tiene poco respeto por la verdad a lo largo de sus escritos.
    El que McDowell haya reconocido al pasaje como “altamente controversial” implica que McDowell conoce los cientos de trabajos que se han hecho sobre este texto. Lo que sucede es que el lector se queda sin saber en qué consiste la controversia. De forma semejante a la ignorancia que fomenta el escritor creacionista cuando “informa” que hay mucho debate en torno a la evolución como prueba de que es falsa y no le explica a su lector en qué consiste el debate.
    El examen más profundo de la validez de este parágrafo particular de Josefo fué hecho por Nathaniel Lardner en 1838. Los hallazgos de Lardner se presentan en su trabajo llamado Testimonios Judíos, que forman el volumen 6 de la recopilación de sus obras. Examinaremos la crítica de Lardner sobre el pasaje de Josefo con cierto detalle, porque ésta misma es la referencia más importante a Jesús como carácter histórico por fuera del Nuevo Testamento, y porque es un buen ejemplo de cómo un fundamentalista trata la evidencia que no le gusta.
    Veamos el texto de Josefo: (Tomado del texto griego estándar aceptado de Antigüedades 18:63-64 por L.H. Feldman en la Biblioteca Clásica Loeb): “Alrededor de este tiempo vivió Jesús, un hombre sabio, si de hecho fuera apropiado llamarlo un hombre. Porque el era uno que ejecutó actos sorprendentes y fue maestro de gente de las que aceptan la verdad con agrado. El atrajo muchos de los judíos y de los griegos. El era el Mesías. Cuando Pilato, al escuchar las acusaciones de los hombres más importantes entre nosotros lo condenó a ser crucificado, aquellos que lo habían amado al inicio no dejaron su afecto por él. Al tercer día el se apareció a ellos restaurado a la vida, porque los profetas de Dios habían profetizado estos y otras incontables cosas maravillosas acerca de él. Y la tribu de los Cristianos, llamada así por él, hasta este día no ha desaparecido.”
    ¿Por qué debemos sospechar que este pasaje es un fraude? Primero, porque aunque los padres de la Iglesia eran adictos a citar pasajes que soportaran el cristianismo, y aunque estos primitivos padres de la Iglesia estaban bastante familiarizados con los trabajos de Josefo, ni uno de ellos cita este pasaje en defensa del cristianismo hasta que Eusebio lo hace en el siglo IV. Orígenes, el famoso apologista cristiano primitivo, incluso cita otras partes de Josefo, pero por alguna razón desprecia el citar nuestro pasaje. Orígenes escribió su libro Contra Celso cerca de 220 A.D.
    Segundo, el pasaje viene en la mitad de una colección de historias acerca de calamidades que le habían sucedido a los Judíos. Ésto no hubiera sido una calamidad.
    Tercero, el pasaje presenta a Josefo, un Judío ortodoxo, diciendo que Jesús era el Mesías. Es altamente improbable que un Judío Fariseo como él hubiera hecho esta afirmación. El pasaje completo se lee como si hubiera sido escrito por un cristiano. Se hace que Josefo llame a la religión cristiana “la verdad”. El difícilmente hubiera dicho éso. Aunque Josefo reporta los milagros de una variedad de otros “profetas”, se queda callado acerca de los milagros atribuídos a Jesús. Otra vez, ésto no tiene sentido cuando se compara con los escritos genuinos conocidos de Josefo. La última frase en la cita “hasta éste día no ha desaparecido.” No tendría sentido a menos que fuera escrita bastante tiempo después de que Jesús hubiera muerto. Josefo, de otro lado, escribió las Antigüedades cerca del 90 A.D.
    Además, en el texto no es claro por qué los seguidores del Mesías debían llamarse Cristianos.
    Hay muchos académicos que sostienen que puede haber un núcleo auténtico sobre Jesús en el pasaje original y que fue reformado por los Cristianos (si les interesa les mando información al respecto), pero también hay una gran cantidad de eruditos que piensan que todo el pasaje es un fraude, o sea que las opiniones están divididas. Así, de ninguna manera es honesto presentar este pasaje como evidencia histórica de algún hecho, pues es obvio que fue interpolado, al menos parcialmente por cristianos. Se cree que fue Eusebio en el siglo IV, al cual me referí anteriormente, quien alteró este pasaje.
    Aún así (y obviamente conociendo esto) McDowell aporta este pasaje como verificación independiente de Jesús. Esto cualquier persona de buen corazón sabe que es deshonesto y tendencioso. Es probable que algunos admiradores del McDowell encuentren esto desconcertante, pero más adelante, creo que el desconcierto se transformará en desilusión e incluso en indignación.
    ——- Cornelio Tácito y las Persecuciones de Nerón
    El siguiente historiador antiguo importante que supuestamente menciona a Jesús, y así nos provee de evidencia de que fué un carácter histórico es Tácito. Cornelio Tácito escribió sus anales después del 117 A.D. Su fecha exacta de composición no se conoce, pero sabemos que fue por lo menos 70 años después de la supuesta crucifixión de Jesús. Jesús no se menciona por nombre en ningún sitio de los trabajos existentes de Tácito. Hay una mención de “Cristus” en el libro XV, Cap. 44, como sigue:
    “Nerón buscó un chivo expiatorio e inflingió las más diabólicas torturas a un grupo de personas ya odiadas por la gente debido a sus crímenes. Esta era la secta conocida como Cristianos. Su fundador, un Cristus, había sido ejecutado por el procurador Poncio Pilato en el reinado de Tiberio. Esto frenó la abominable superstición por un tiempo, pero se surgió otra vez y se esparció, no únicamente a través de Judea, donde se originó, sino incluso en Roma misma, la gran reserva y tierra labrada para todo tipo de depravación y obscenidad. Aquéllos que confesaban ser cristianos eran arrestados de inmediato, y en su testimonio una gran multitud de personas fueron convictas, no tanto por el cargo de incendio sino de hostilidad ante la raza humana en su totalidad.” ( Traducción de D.R. Dudley)
    Es obvio por la forma en que lo anterior está escrito, que Tácito no afirma tener conocimiento de primera mano de los orígenes del cristianismo sino que está repitiendo una historia que era comúnmente creída, a saber, que el fundador del Cristianismo, un Cristus, había sido ejecutado bajo el reinado de Tiberio. (Análogo al ejemplo de Baal y los babilonios que ya mencioné)
    Hay serias dificultades que deben ser resueltas antes de que este pasaje pueda ser aceptado como genuino.
    Al contrario de lo que nos hacen creer en las clases de Religión y en las películas de Hollywood, no hay ninguna otra prueba histórica de que Nerón persiguiera a los cristianos en absoluto. También se cree que la supuesta persecución de Nerón a los cristianos en este texto es una interpolación cristiana basada en los Martirologios, obviamente sin ningún valor histórico, escritos por los padres de la Iglesia Católica. (A quien le interese, con mucho gusto háganme saber, para ampliar sobre el tema).
    Además, es casi seguro que no había multitudes de cristianos en Roma en esa fecha (aproximadamente en 60 AD.). De hecho, el término “cristiano” no era de uso común en el primer siglo. Sabemos que Nerón era indiferente a varias religiones en su ciudad y puesto que él definitivamente NO INICIÓ el fuego en Roma, no necesitaba ningún grupo que le sirviera como chivo expiatorio.
    Además es improbable que esto texto de Tácito sea resultado de la búsqueda en algún archivo, porque los romanos difícilmente mantenían registros de las incontables crucifixiones alrededor del imperio remontándose a casi un siglo atrás . (No había Software). Además, Tácito no es conocido como un investigador profundo, lo que se ilustra por el hecho de que se equivoca al asignarle el título a Pilatos.
    Tal vez, más incriminante para la autenticidad de este pasaje es el hecho de que está presente casi palabra por palabra en la Crónica de Sulpicio Severo (muerto en el 403 A.D.), donde se encuentra mezclado con historias obviamente falsas. Al mismo tiempo, es altamente improbable que Sulpicio hubiera copiado este pasaje de Tácito, porque ninguno de sus contemporáneos menciona el pasaje. Esto significa que probablemente no estaba en los manuscritos de Tácito en esa fecha. Es mucho más probable, entonces, que los copistas trabajando en las Edades Oscuras a partir del único manuscrito existente de la Crónica, simplemente copiaran le pasaje de Sulpicio en el manuscrito de Tácito que estaban reproduciendo.
    Con todas estas evidencias en contra, que se pueden encontrar en trabajos serios (a diferencia del de McDowell ), es un completo despropósito usar este texto como soporte de la historicidad del personaje Jesús.
    Gordon Stein
    ———-
    Saludos
    Walter

  279. Everardo segobiano garcia says:

    cada quien escribe lo que quiere de jesus pero yo en lo personal lo respeto mucho y no se vale desspotricar en su nombre pero cada quien no

  280. yoco says:

    La iglesia desde que existe ha ocasionado guerras, miseria, no solo aqui, sino en todo el mundo…… si no hubiera religiones seriamos mas felices.
    Viva cristo rey y su puta madre. Yo tambien me cago en dios, que de existir, no dejaba morir de hambre a los niños en africa, a menos que en vez de dios sea satanas. Me da asco la iglesia con sus calices de oro. Y punto.

  281. Pepe says:

    Esa expresión es eslógan de la violencia fascista de la falange española. No tiene nada que ver con dioses ni leches, sino que representa la ideología nacionalcristiana de esa organización. La apología del nazismo hace algunos añitos que está tipificada como delito por las NU (Naciones Unidas).

  282. Norma says:

    Saludos: Yo veo que tanto Junjuan, Walter y Chapulin Colorado estan claros en sus convicciones y eso es digno de encomio, aunque a veces se le va la mano, en cuanto a palabras groseras; pero esposible que en el lugar donde ellos se criaron no se consideren tan fuertes.
    Es bueno tomar en cuenta que esto se lee en todas partes donde hay internet y las costumbres varian de lugar en lugar y todos debemos de darle el debido respeto dentro de las circunstancias posibles a todos los que interevienen en este foro y en otros. No piensen que los estoy elogiando aunque asi parezca, pero noto que tienen cultura y conocen muy bien sus puntos de vista, incluso mejor que muchos de los que somos creyentes a nuestra manera y eso hay que reconocerlo, desde luego eso implica que los creyentes debemos de estudiar con mayor profundidad las cosas de Dios desde una optica cientifica, porque a excepcion de unos pocos dentro de nosotros mismos la gran mayoria no sabe ni porque cree en Dios. Norma

  283. Norma says:

    ¿Quiso decir Dios “No matarás”?
    ¿QUIÉN no ha oído a alguien decir: ‘En los Diez Mandamientos Dios manda: “No matarás”’? En guerras recientes algunos hombres han dado eso como su razón para rehusar pelear. También surge cuando se considera la pena capital.
    Pero hay otros que se refieren a este mandamiento al tratar de mostrar que la Biblia se contradice. Un folleto que se publicó con ese propósito tiene el encabezamiento “Prohibido el matar” y alista “No matarás. (Éxo. xx. 13.)” pero luego llama la atención a casos en los que Dios les dijo a los israelitas que ejecutaran a otros. (Éxo. 32:27; 2 Rey. 10:11, 30) Y Yaweh dirigió a los israelitas a exterminar naciones enemigas. (Deu. 7:1, 2, 16; 12:31; Jos. 6:12-21) De modo que ¿realmente mandó Dios: “No matarás”? ¿Qué quiere decir el sexto de los Diez Mandamientos? ¿Y hace categóricamente inadmisibles las guerras y la pena capital?
    La frase “No matarás” suena familiar a la mayoría de las personas porque así es como vierten Éxodo 20:13 casi todas las traducciones al español. (Deu. 5:17) Pero, si usted busca este texto en algunas traducciones modernas al inglés como Today’s English Version, The New English Bible y también las traducciones por Moffatt, Fenton, T. F. Meek y R. Knox, notará que dicen esto mismo o “No debes cometer asesinato.” ¿Por qué la diferencia?
    En el hebreo original la palabra utilizada es ratsahh, que literalmente significa “romper” o “hacer añicos.” En su léxico hebreo, el erudito John Parkhurst explica que en la Biblia ratsahh “denota homicidio impremeditado o asesinato, es decir, el quitarle la vida a un hombre ya sea accidental o voluntariosamente.”
    Es digno de notarse que de las 47 veces que se emplea ratsahh en las Escrituras Hebreas, 33 veces se hace con referencia a las ciudades de refugio de Israel. Estas ciudades servían en casos de quitarle un hombre la vida a otro. Si se determinaba judicialmente que la muerte no se había causado intencionalmente, el causante podía permanecer en la ciudad. Pero si la investigación legal manifestaba que había matado con premeditación o deliberación, lo pagaba con su propia vida. Teniendo presentes estas dos posibilidades, note cómo ratsahh se traduce apropiadamente tres veces:
    “Como ciudades de refugio les servirán a ustedes, y allí tiene que huir el homicida que hiera mortalmente a un alma sin intención. . . . Ahora bien, si fue con instrumento de hierro [usado deliberadamente como arma] que lo ha herido de modo que muera, es un asesino. Sin falta debe dársele muerte al asesino.”—Núm. 35:6, 11-34; Deu. 4:41-43; 19:1-7; Jos. 20:2-6; 21:13-39.
    Otros versículos indican que ratsahh generalmente aplicaba al acto de quitar una vida humana ilegalmente, contrario a la ley de Dios. Note las cosas que se mencionan asociadas con ello en Oseas 4:2: “Hay la pronunciación de maldiciones y práctica de engaño y asesinato y robo y perpetración de adulterio que han estallado, y actos de derramamiento de sangre han tocado a otros actos de derramamiento de sangre.”—Jer. 7:9.
    Como se muestra en lo susodicho respecto al castigo del asesino deliberado, no todo caso de quitar una vida humana se consideraba ratsahh (asesinato), ni sería prohibido por el sexto de los Diez Mandamientos. Después del diluvio Yaweh le dijo significativamente a Noé: “Cualquiera que derrame la sangre del hombre, por el hombre será derramada su propia sangre, porque a la imagen de Dios hizo él al hombre.” (Gén. 9:6) Sí, aun antes de dar a Israel un código de leyes, Dios permitió la pena capital. ‘El derramar la sangre del hombre’ por medio de asesinarlo era lo que el Sexto Mandamiento prohibía, no la ejecución legal de un asesino.
    Esto nos ayuda a reconocer lo apropiado del uso de ratsahh en conexión con el rey Acab. El rey codiciaba la viña de Nabot y a fin de conseguirla dejó que mataran al hombre. Esto no era la ejecución legalmente justificada de alguien que había cometido una ofensa capital en Israel. Era un acto ilegal de matar a un hombre, algo prohibido por el Sexto Mandamiento. Acab era un “asesino” y merecía morir.—1 Rey. 21:1-10; 2 Rey. 6:32; Lev. 24:17.
    Pero, ¿qué hay de las guerras de Israel? ¿Violaron el mandato que se vierte correctamente: “No debes asesinar”?
    No, no lo violaron. La verdad es que la Biblia nunca usa el término ratsahh (asesinato) respecto a ninguna de esas guerras. Cuando los israelitas guerreaban en obediencia al mandato de Dios, no estaban obrando ilegalmente. El que los autorizaba a hacerlo y los dirigía era el Legislador Supremo. (Isa. 33:22; Sal. 19:7) Estas guerras no tenían por objeto conquistar territorios ilimitados, como es el caso con muchas guerras nacionales de tiempos recientes. No fueron guerras motivadas por la avaricia económica. Tampoco fueron guerras que violaban tratados de paz o pactos de no agresión legalmente arreglados, como lo han sido algunas guerras de la historia moderna.
    Absolutamente no hay nación en la Tierra hoy día que esté enteramente compuesta de personas que adoran a Jehová, a quienes él dirija milagrosamente por medio de profetas y que tengan una concesión Divina para poseer cierta porción de la Tierra. Pero todo eso fue cierto en el caso del antiguo Israel. Jehová había notado que los habitantes de Canaán estaban empapados en la iniquidad, estaban totalmente depravados y merecían la ejecución. (Gén. 15:13-21; Lev. 18:24, 25) Dios, como dueño de toda la Tierra, se determinó a dar ese territorio a la nación de Israel. Y, bajo la dirección de comandantes que él escogió para eso, Dios usó a Israel para ejecutar su juicio contra los cananeos.—Deu. 9:4, 5; 12:31; Jos. 10:40.
    Por lo tanto, cuando los israelitas ejecutaban los juicios legales y moralmente rectos de Jehová, o defendían la tierra que Dios les dio, no se les podía culpar de violar el mandato: “No debes asesinar.”
    ¿Qué hay de los cristianos? Puesto que el Sexto Mandamiento simplemente declaró lo que Dios ya le había dicho a la entera familia humana por medio de Noé, todavía estamos obligados a evitar el asesinar. En realidad, los capítulos finales de la Biblia nos advierten que los asesinos que no se arrepientan experimentarán la destrucción eterna en la “muerte segunda.” (Rev. 21:8; 22:15) Esto nos ayuda a ver la importancia de no participar en quitar vidas humanas sin la autorización específicamente declarada de Dios. Consistente con esto, se describe proféticamente a los verdaderos adoradores de Dios en Isaías 2:3, 4 donde dice: “Y muchos pueblos ciertamente irán y dirán: ‘Vengan, y subamos a la montaña de Jehová, a la casa del Dios de Jacob; y él nos instruirá acerca de sus caminos, . . .’ Y tendrán que batir sus espadas en rejas de arado y sus lanzas en podaderas. . . . Ni aprenderán más la guerra.”
    Además, a los cristianos se les advierte que los asesinatos provienen de un corazón malo. (Mat. 5:21-26; 15:19) Si alguien permitiera que el odio a un compañero cristiano se desarrollara en su corazón, sería igual a ser un homicida o asesino, lo cual hay que evitar.—1 Juan 3:15.
    De modo que la traducción “No matarás” realmente no comunica el verdadero sabor del Sexto Mandamiento. La traducción más correcta es: “No debes asesinar.” El entender esto nos ayuda a reconocer que las guerras justas de Israel no violaron ese mandato. Y podemos comprender mejor su significado en relación con nuestra conducta y actitud respecto a tomar la vida de un ser humano.

  284. Norma says:

    La revista New Scientist del 22-29 de diciembre de 1990 publicó una idea parecida: “El método tolemaico se ha aplicado profusamente al […] modelo cosmológico del Big Bang”. Y luego preguntó: “¿Cómo podemos alcanzar verdadero progreso en la física de partículas y la cosmología? […] Tenemos que ser más honrados y francos en cuanto a la naturaleza meramente especulativa de algunas de nuestras suposiciones más preciadas”. Hoy día llegan de continuo observaciones nuevas.
    Uno de los mayores obstáculos a los que se enfrenta la teoría del Big Bang proviene de los estudios efectuados con el sistema óptico corregido del telescopio espacial Hubble para medir la distancia que nos separa de otras galaxias. Los nuevos datos están consternando a los teóricos.
    La astrónoma Wendy Freedman y su equipo utilizaron recientemente el telescopio espacial Hubble para medir la distancia a la que se halla una galaxia del cúmulo de Virgo, y su medición indica que el universo se expande más deprisa de lo que hasta ahora se creía, y por lo tanto, es más joven. De hecho, la nueva medición presupone “una edad del universo muy pequeña: ocho mil millones de años”, decía el pasado mes de agosto la revista Investigación y Ciencia. Aunque ocho mil millones de años parece mucho tiempo, es solo aproximadamente la mitad de la edad que suele atribuirse actualmente al universo, lo que plantea un problema paradójico, pues, como sigue diciendo el artículo de la citada revista, “otros datos indican que ciertas estrellas tienen por lo menos catorce mil millones de años”. Si los cálculos de Freedman son acertados, esas estrellas serían más antiguas que el propio Big Bang.
    Otro problema al que se enfrenta la teoría del Big Bang proviene del testimonio cada vez mayor de que en el universo existen “burbujas” de 100.000.000 de años luz de diámetro en cuyo exterior hay galaxias y que por dentro están vacías. Margaret Geller, John Huchra y otros científicos del centro de astrofísica Harvard-Smithsonian han descubierto lo que ellos denominan una “gran muralla” de galaxias que se extiende a lo largo de unos 500.000.000 de años luz en el hemisferio norte. Otro grupo de astrónomos, conocidos como los “siete samuráis”, han encontrado datos que indican la existencia de un conglomerado cósmico distinto, al que denominan el “gran atractor”, situado cerca de las constelaciones de Hydra y Centauro (en el hemisferio sur). Los astrónomos Marc Postman y Tod Lauer creen que más allá de la constelación de Orión tiene que haber algo aún mayor que tira de centenares de galaxias, incluida la nuestra, desplazándolas en esa dirección como si fueran balsas en una especie de “río espacial”.
    Toda esta estructura es desconcertante. Los cosmólogos dicen que la onda expansiva del Big Bang fue sumamente lisa y uniforme, según la radiación de fondo que supuestamente dejó detrás. ¿Cómo es posible que de un comienzo tan liso salieran estructuras tan inmensas y complejas? “La última cosecha de murallas y atractores hace más intenso el misterio de la formación de tanta estructura en los quince mil millones de años que tiene el universo”, admite Investigación y Ciencia. Y a medida que Freedman y otros científicos reducen aún más la edad calculada del cosmos, el problema sigue empeorando.
    Los mapas tridimensionales de Margaret Geller, en los que aparecen miles de aglomeraciones galácticas apiñadas, enredadas y en forma de burbuja, han transformado el concepto que los científicos tenían de la estructura del universo. Geller no pretende entender lo que ve. La gravedad en sí no parece explicar la gran muralla que descubrió. “Muchas veces pienso que al tratar de entender esta estructura estamos olvidando algún elemento fundamental”, admite.
    Con relación a sus presentimientos, Margaret Geller añadió: “No sabemos con exactitud cómo interpretar en el contexto del Big Bang la enorme estructuración [de galaxias]”. Las interpretaciones que se hacen de la estructura cósmica, basadas en los mapas actuales de los cielos, distan mucho de ser definitivas. Es como tratar de imaginarse el mundo entero consultando un mapa de Puerto Rico. Geller continuó: “Quizás algún día descubramos que no hemos estado colocando las piezas en su debido lugar, y cuando las coloquemos bien, parecerá tan obvio que nos preguntaremos por qué no se nos había ocurrido colocarlas así mucho antes”.
    Eso nos lleva a la pregunta más importante: ¿Qué fue lo que supuestamente dio origen al Big Bang? Andrei Linde, uno de los originadores de la popularísima versión inflacionaria de la gran explosión admite francamente que la teoría convencional no aclara esta pregunta fundamental. “El primer problema, y más importante, es la propia existencia de la gran explosión —dice—. ¿Qué hubo antes? Si el espacio-tiempo no existía, ¿cómo pudo todo aparecer de la nada? […] Explicar esta singularidad inicial, dónde y cuándo empezó todo, sigue siendo uno de los problemas más arduos de la cosmología moderna.”
    Un artículo de la revista Discover concluyó recientemente que “ningún cosmólogo razonable afirmaría que el Big Bang es la teoría definitiva”.
    Salgamos ahora al exterior y contemplemos la belleza y el misterio de la bóveda estrellada.
    Norma

  285. Norma says:

    ¿ADN “chatarra”?
    MUCHOS investigadores que estudian biología, genética y materias relacionadas lo hacen desde la perspectiva de la teoría de la evolución, pero esa visión a menudo los ha llevado a falsas conclusiones. Por ejemplo, los primeros darwinistas calificaron de rudimentarios ciertos órganos, como el apéndice, la hipófisis y las amígdalas. Para ellos, eran vestigios del proceso evolutivo porque les parecía que ya no cumplían ninguna función en el organismo. Sin embargo, con el tiempo se descubrió su importante papel, y las antiguas ideas evolucionistas se fueron a la basura.
    Algo parecido ha ocurrido recientemente en el campo de la genética. Según las primeras investigaciones, el 98% del ADN del ser humano y otros organismos carecía de función específica, y muchas personas que estaban influidas por la teoría de la evolución dieron por hecho que era “chatarra evolutiva”. Su opinión se convirtió en dogma.
    Pero de nuevo resultó falsa una suposición basada en el darwinismo. La ciencia descubrió hace poco que ese ADN “chatarra” es esencial en el organismo, pues produce variedades específicas de ARN (ácido ribonucleico) indispensables para la vida. John S. Mattick, director del Instituto de Biociencia Molecular de la Universidad de Queensland (Australia), considera que la premura con que se aceptó la teoría del ADN “chatarra” es “un ejemplo clásico de cómo la doctrina admitida puede desvirtuar la interpretación de las observaciones, en este caso, durante un cuarto de siglo”. Este hecho “ha constituido uno de los grandes errores sufridos por la biología molecular”.
    ¿No es más sensato creer que el ADN tiene un Diseñador inteligente? Quien lo ve de tal manera descubre que, con el tiempo, suelen salir a la luz las razones de algunos aspectos intrigantes de la obra de Dios. Y, en lugar de que esa persona se sienta decepcionada, tales descubrimientos la llenan aún más de admiración.
    Hoy se sabe que las características que heredamos de nuestros padres y abuelos —la estatura, los rasgos faciales, el color del pelo y de los ojos, entre otras miles— vienen definidas por nuestros genes. Cada célula contiene decenas de miles de genes, y cada gen forma parte de una larga cadena de ADN (ácido desoxirribonucleico). Las instrucciones para la formación de nuestro cuerpo se hallan “escritas” en la estructura química del ADN. Cada vez que las células se dividen para producir células nuevas o reemplazar las que están gastadas, el ADN transmite dichas instrucciones, lo que nos permite seguir vivos y conservar básicamente la misma apariencia. ¡Qué extraordinario ejemplo del poder y sabiduría de nuestro Hacedor celestial!
    El primer gran interrogante tiene que ver con lo bien regulado que está el cosmos. En efecto, ¿por qué está regido por leyes físicas de carácter inmutable y constantes naturales que resultan ideales para la Tierra y la vida que alberga?
    Antes que nada, ¿qué se quiere decir con “bien regulado”? Tomemos por caso la intensidad de las fuerzas físicas fundamentales: el electromagnetismo, la gravedad, la interacción nuclear fuerte y la interacción nuclear débil. Las cuatro actúan sobre todos los objetos del universo y están ajustadas y equilibradas con tanta precisión, que el menor cambio acabaría con la vida existente.
    A muchas mentes pensantes no les satisface la explicación de que tal exactitud sea pura coincidencia. El físico John Polkinghorne, que trabajó en la Universidad de Cambridge, llegó a esta conclusión: “Al comprender que las leyes de la naturaleza deben estar ajustadas con extraordinaria precisión para que exista el mundo visible, surge con fuerza en nuestro interior la idea de que este no se originó por casualidad, sino con una finalidad”.
    El físico australiano Paul Davies suscribe la misma opinión: “No cabe duda de que muchos científicos se oponen temperamentalmente […]. Desdeñan la idea de que pueda existir un Dios, o inclusive un sustrato o principio creativo impersonal […]. Personalmente, no comparto su desdén. […] No puedo creer que nuestra existencia en el universo sea un mero capricho del destino, […] un destello fortuito en el gran drama cósmico”.El segundo interrogante científico lo plantea la inmensa complejidad del mundo que nos rodea. Es de sentido común: cuanto más complicado es algo, menos probable es que haya surgido por casualidad. Veamos un ejemplo.
    Para que se forme una molécula de ADN, unidad esencial de la vida, tienen que sucederse con precisión múltiples reacciones químicas. Hace tres decenios, el doctor Frank Salisbury, de la Universidad del Estado de Utah (EE.UU.), calculó que la aparición espontánea de una molécula básica de ADN contaba con unas posibilidades tan ínfimas que cabía calificarla de imposibilidad matemática.
    La complejidad resulta aún más obvia cuando los seres vivos poseen órganos compuestos que serían inútiles de no existir otros órganos igualmente especializados. Sirva de botón de muestra la facultad de la reproducción.
    Según las teorías evolucionistas, los organismos fueron reproduciéndose al tiempo que se hacían más intrincados. Pero en algún punto, la hembra de ciertas especies tuvo que haber desarrollado células reproductivas que requerían la fertilización por parte de las células complementarias del macho. Además, a fin de transmitir a su descendencia el número debido de cromosomas, las células reproductivas de ambos padres pasan por la meiosis, singular proceso que les reduce a la mitad el número usual de cromosomas. De este modo, no se produce un exceso cromosómico en la descendencia.
    Ahora bien, este proceso tuvo que haberse dado en otras especies. Entonces, ¿de qué manera se las arregló cada “primera madre” para reproducirse con un “primer padre” plenamente desarrollado? ¿Cómo consiguieron de golpe reducir a la mitad el número de cromosomas en sus células reproductoras respectivas a fin de tener descendientes sanos con las características de los dos? Además, si estos medios genéticos surgieron poco a poco, hubo un momento en que su formación fue parcial. En tales circunstancias, ¿cómo pudo haber sobrevivido cada macho y cada hembra?
    ¿Cuántas probabilidades hay de que la interdependencia reproductiva sea fruto del azar? Si el cálculo se limita a una sola especie, el resultado es inconmensurablemente bajo, pero si se aplica a todas, la cifra ya desafía toda lógica. ¿Logran explicar tal complejidad las hipótesis evolucionistas? ¿Cómo es posible que una serie de accidentes, sucesos aleatorios sin finalidad alguna, hayan dado origen a sistemas interrelacionados de forma tan compleja? Los seres vivos presentan un sinnúmero de características que indican previsión y planificación, lo que a su vez implica la existencia de un Planificador inteligente.
    Muchos especialistas han llegado a esa conclusión. Por ejemplo, el matemático William A. Dembski escribió que el “diseño inteligente” que se manifiesta en determinados “aspectos observables del mundo natural […] solo puede explicarse adecuadamente recurriendo a causas inteligentes”. Michael Behe, bioquímico molecular, resume así la situación: “Es posible ser buen católico y creer en el darwinismo. Sin embargo, a consecuencia de la bioquímica, es cada vez más difícil ser un científico serio y aceptar dicha hipótesis”.
    Todo lo anterior es una muestra mínima del cúmulo de preguntas que quedan sin respuesta si se desestiman las pruebas de que existe un Creador. Algunos científicos comprenden que rechazar a Dios no es una senda fundada en hechos demostrados y lógica cuidadosa, sino en conjeturas aventuradas.
    Tras una vida coronada de éxitos en sus investigaciones y labores en el campo de la astronomía, Allan Sandage dijo: “Fueron mis conocimientos científicos los que me llevaron a concluir que el mundo presenta complicaciones mucho mayores que las que logra esclarecer la ciencia. Solo puedo entender el misterio de la existencia recurriendo al elemento sobrenatur
    Norma

  286. Norma says:

    ¿ADN “chatarra”?
    MUCHOS investigadores que estudian biología, genética y materias relacionadas lo hacen desde la perspectiva de la teoría de la evolución, pero esa visión a menudo los ha llevado a falsas conclusiones. Por ejemplo, los primeros darwinistas calificaron de rudimentarios ciertos órganos, como el apéndice, la hipófisis y las amígdalas. Para ellos, eran vestigios del proceso evolutivo porque les parecía que ya no cumplían ninguna función en el organismo. Sin embargo, con el tiempo se descubrió su importante papel, y las antiguas ideas evolucionistas se fueron a la basura.
    Algo parecido ha ocurrido recientemente en el campo de la genética. Según las primeras investigaciones, el 98% del ADN del ser humano y otros organismos carecía de función específica, y muchas personas que estaban influidas por la teoría de la evolución dieron por hecho que era “chatarra evolutiva”. Su opinión se convirtió en dogma.
    Pero de nuevo resultó falsa una suposición basada en el darwinismo. La ciencia descubrió hace poco que ese ADN “chatarra” es esencial en el organismo, pues produce variedades específicas de ARN (ácido ribonucleico) indispensables para la vida. John S. Mattick, director del Instituto de Biociencia Molecular de la Universidad de Queensland (Australia), considera que la premura con que se aceptó la teoría del ADN “chatarra” es “un ejemplo clásico de cómo la doctrina admitida puede desvirtuar la interpretación de las observaciones, en este caso, durante un cuarto de siglo”. Este hecho “ha constituido uno de los grandes errores sufridos por la biología molecular”.
    ¿No es más sensato creer que el ADN tiene un Diseñador inteligente? Quien lo ve de tal manera descubre que, con el tiempo, suelen salir a la luz las razones de algunos aspectos intrigantes de la obra de Dios. Y, en lugar de que esa persona se sienta decepcionada, tales descubrimientos la llenan aún más de admiración.
    Hoy se sabe que las características que heredamos de nuestros padres y abuelos —la estatura, los rasgos faciales, el color del pelo y de los ojos, entre otras miles— vienen definidas por nuestros genes. Cada célula contiene decenas de miles de genes, y cada gen forma parte de una larga cadena de ADN (ácido desoxirribonucleico). Las instrucciones para la formación de nuestro cuerpo se hallan “escritas” en la estructura química del ADN. Cada vez que las células se dividen para producir células nuevas o reemplazar las que están gastadas, el ADN transmite dichas instrucciones, lo que nos permite seguir vivos y conservar básicamente la misma apariencia. ¡Qué extraordinario ejemplo del poder y sabiduría de nuestro Hacedor celestial!
    El primer gran interrogante tiene que ver con lo bien regulado que está el cosmos. En efecto, ¿por qué está regido por leyes físicas de carácter inmutable y constantes naturales que resultan ideales para la Tierra y la vida que alberga?
    Antes que nada, ¿qué se quiere decir con “bien regulado”? Tomemos por caso la intensidad de las fuerzas físicas fundamentales: el electromagnetismo, la gravedad, la interacción nuclear fuerte y la interacción nuclear débil. Las cuatro actúan sobre todos los objetos del universo y están ajustadas y equilibradas con tanta precisión, que el menor cambio acabaría con la vida existente.
    A muchas mentes pensantes no les satisface la explicación de que tal exactitud sea pura coincidencia. El físico John Polkinghorne, que trabajó en la Universidad de Cambridge, llegó a esta conclusión: “Al comprender que las leyes de la naturaleza deben estar ajustadas con extraordinaria precisión para que exista el mundo visible, surge con fuerza en nuestro interior la idea de que este no se originó por casualidad, sino con una finalidad”.
    El físico australiano Paul Davies suscribe la misma opinión: “No cabe duda de que muchos científicos se oponen temperamentalmente […]. Desdeñan la idea de que pueda existir un Dios, o inclusive un sustrato o principio creativo impersonal […]. Personalmente, no comparto su desdén. […] No puedo creer que nuestra existencia en el universo sea un mero capricho del destino, […] un destello fortuito en el gran drama cósmico”.El segundo interrogante científico lo plantea la inmensa complejidad del mundo que nos rodea. Es de sentido común: cuanto más complicado es algo, menos probable es que haya surgido por casualidad. Veamos un ejemplo.
    Para que se forme una molécula de ADN, unidad esencial de la vida, tienen que sucederse con precisión múltiples reacciones químicas. Hace tres decenios, el doctor Frank Salisbury, de la Universidad del Estado de Utah (EE.UU.), calculó que la aparición espontánea de una molécula básica de ADN contaba con unas posibilidades tan ínfimas que cabía calificarla de imposibilidad matemática.
    La complejidad resulta aún más obvia cuando los seres vivos poseen órganos compuestos que serían inútiles de no existir otros órganos igualmente especializados. Sirva de botón de muestra la facultad de la reproducción.
    Según las teorías evolucionistas, los organismos fueron reproduciéndose al tiempo que se hacían más intrincados. Pero en algún punto, la hembra de ciertas especies tuvo que haber desarrollado células reproductivas que requerían la fertilización por parte de las células complementarias del macho. Además, a fin de transmitir a su descendencia el número debido de cromosomas, las células reproductivas de ambos padres pasan por la meiosis, singular proceso que les reduce a la mitad el número usual de cromosomas. De este modo, no se produce un exceso cromosómico en la descendencia.
    Ahora bien, este proceso tuvo que haberse dado en otras especies. Entonces, ¿de qué manera se las arregló cada “primera madre” para reproducirse con un “primer padre” plenamente desarrollado? ¿Cómo consiguieron de golpe reducir a la mitad el número de cromosomas en sus células reproductoras respectivas a fin de tener descendientes sanos con las características de los dos? Además, si estos medios genéticos surgieron poco a poco, hubo un momento en que su formación fue parcial. En tales circunstancias, ¿cómo pudo haber sobrevivido cada macho y cada hembra?
    ¿Cuántas probabilidades hay de que la interdependencia reproductiva sea fruto del azar? Si el cálculo se limita a una sola especie, el resultado es inconmensurablemente bajo, pero si se aplica a todas, la cifra ya desafía toda lógica. ¿Logran explicar tal complejidad las hipótesis evolucionistas? ¿Cómo es posible que una serie de accidentes, sucesos aleatorios sin finalidad alguna, hayan dado origen a sistemas interrelacionados de forma tan compleja? Los seres vivos presentan un sinnúmero de características que indican previsión y planificación, lo que a su vez implica la existencia de un Planificador inteligente.
    Muchos especialistas han llegado a esa conclusión. Por ejemplo, el matemático William A. Dembski escribió que el “diseño inteligente” que se manifiesta en determinados “aspectos observables del mundo natural […] solo puede explicarse adecuadamente recurriendo a causas inteligentes”. Michael Behe, bioquímico molecular, resume así la situación: “Es posible ser buen católico y creer en el darwinismo. Sin embargo, a consecuencia de la bioquímica, es cada vez más difícil ser un científico serio y aceptar dicha hipótesis”.
    Todo lo anterior es una muestra mínima del cúmulo de preguntas que quedan sin respuesta si se desestiman las pruebas de que existe un Creador. Algunos científicos comprenden que rechazar a Dios no es una senda fundada en hechos demostrados y lógica cuidadosa, sino en conjeturas aventuradas.
    Tras una vida coronada de éxitos en sus investigaciones y labores en el campo de la astronomía, Allan Sandage dijo: “Fueron mis conocimientos científicos los que me llevaron a concluir que el mundo presenta complicaciones mucho mayores que las que logra esclarecer la ciencia. Solo puedo entender el misterio de la existencia recurriendo al elemento sobrenatur
    Norma

  287. Norma says:

    ¿ADN “chatarra”?
    MUCHOS investigadores que estudian biología, genética y materias relacionadas lo hacen desde la perspectiva de la teoría de la evolución, pero esa visión a menudo los ha llevado a falsas conclusiones. Por ejemplo, los primeros darwinistas calificaron de rudimentarios ciertos órganos, como el apéndice, la hipófisis y las amígdalas. Para ellos, eran vestigios del proceso evolutivo porque les parecía que ya no cumplían ninguna función en el organismo. Sin embargo, con el tiempo se descubrió su importante papel, y las antiguas ideas evolucionistas se fueron a la basura.
    Algo parecido ha ocurrido recientemente en el campo de la genética. Según las primeras investigaciones, el 98% del ADN del ser humano y otros organismos carecía de función específica, y muchas personas que estaban influidas por la teoría de la evolución dieron por hecho que era “chatarra evolutiva”. Su opinión se convirtió en dogma.
    Pero de nuevo resultó falsa una suposición basada en el darwinismo. La ciencia descubrió hace poco que ese ADN “chatarra” es esencial en el organismo, pues produce variedades específicas de ARN (ácido ribonucleico) indispensables para la vida. John S. Mattick, director del Instituto de Biociencia Molecular de la Universidad de Queensland (Australia), considera que la premura con que se aceptó la teoría del ADN “chatarra” es “un ejemplo clásico de cómo la doctrina admitida puede desvirtuar la interpretación de las observaciones, en este caso, durante un cuarto de siglo”. Este hecho “ha constituido uno de los grandes errores sufridos por la biología molecular”.
    ¿No es más sensato creer que el ADN tiene un Diseñador inteligente? Quien lo ve de tal manera descubre que, con el tiempo, suelen salir a la luz las razones de algunos aspectos intrigantes de la obra de Dios. Y, en lugar de que esa persona se sienta decepcionada, tales descubrimientos la llenan aún más de admiración.
    Hoy se sabe que las características que heredamos de nuestros padres y abuelos —la estatura, los rasgos faciales, el color del pelo y de los ojos, entre otras miles— vienen definidas por nuestros genes. Cada célula contiene decenas de miles de genes, y cada gen forma parte de una larga cadena de ADN (ácido desoxirribonucleico). Las instrucciones para la formación de nuestro cuerpo se hallan “escritas” en la estructura química del ADN. Cada vez que las células se dividen para producir células nuevas o reemplazar las que están gastadas, el ADN transmite dichas instrucciones, lo que nos permite seguir vivos y conservar básicamente la misma apariencia. ¡Qué extraordinario ejemplo del poder y sabiduría de nuestro Hacedor celestial!
    El primer gran interrogante tiene que ver con lo bien regulado que está el cosmos. En efecto, ¿por qué está regido por leyes físicas de carácter inmutable y constantes naturales que resultan ideales para la Tierra y la vida que alberga?
    Antes que nada, ¿qué se quiere decir con “bien regulado”? Tomemos por caso la intensidad de las fuerzas físicas fundamentales: el electromagnetismo, la gravedad, la interacción nuclear fuerte y la interacción nuclear débil. Las cuatro actúan sobre todos los objetos del universo y están ajustadas y equilibradas con tanta precisión, que el menor cambio acabaría con la vida existente.
    A muchas mentes pensantes no les satisface la explicación de que tal exactitud sea pura coincidencia. El físico John Polkinghorne, que trabajó en la Universidad de Cambridge, llegó a esta conclusión: “Al comprender que las leyes de la naturaleza deben estar ajustadas con extraordinaria precisión para que exista el mundo visible, surge con fuerza en nuestro interior la idea de que este no se originó por casualidad, sino con una finalidad”.
    El físico australiano Paul Davies suscribe la misma opinión: “No cabe duda de que muchos científicos se oponen temperamentalmente […]. Desdeñan la idea de que pueda existir un Dios, o inclusive un sustrato o principio creativo impersonal […]. Personalmente, no comparto su desdén. […] No puedo creer que nuestra existencia en el universo sea un mero capricho del destino, […] un destello fortuito en el gran drama cósmico”.El segundo interrogante científico lo plantea la inmensa complejidad del mundo que nos rodea. Es de sentido común: cuanto más complicado es algo, menos probable es que haya surgido por casualidad. Veamos un ejemplo.
    Para que se forme una molécula de ADN, unidad esencial de la vida, tienen que sucederse con precisión múltiples reacciones químicas. Hace tres decenios, el doctor Frank Salisbury, de la Universidad del Estado de Utah (EE.UU.), calculó que la aparición espontánea de una molécula básica de ADN contaba con unas posibilidades tan ínfimas que cabía calificarla de imposibilidad matemática.
    La complejidad resulta aún más obvia cuando los seres vivos poseen órganos compuestos que serían inútiles de no existir otros órganos igualmente especializados. Sirva de botón de muestra la facultad de la reproducción.
    Según las teorías evolucionistas, los organismos fueron reproduciéndose al tiempo que se hacían más intrincados. Pero en algún punto, la hembra de ciertas especies tuvo que haber desarrollado células reproductivas que requerían la fertilización por parte de las células complementarias del macho. Además, a fin de transmitir a su descendencia el número debido de cromosomas, las células reproductivas de ambos padres pasan por la meiosis, singular proceso que les reduce a la mitad el número usual de cromosomas. De este modo, no se produce un exceso cromosómico en la descendencia.
    Ahora bien, este proceso tuvo que haberse dado en otras especies. Entonces, ¿de qué manera se las arregló cada “primera madre” para reproducirse con un “primer padre” plenamente desarrollado? ¿Cómo consiguieron de golpe reducir a la mitad el número de cromosomas en sus células reproductoras respectivas a fin de tener descendientes sanos con las características de los dos? Además, si estos medios genéticos surgieron poco a poco, hubo un momento en que su formación fue parcial. En tales circunstancias, ¿cómo pudo haber sobrevivido cada macho y cada hembra?
    ¿Cuántas probabilidades hay de que la interdependencia reproductiva sea fruto del azar? Si el cálculo se limita a una sola especie, el resultado es inconmensurablemente bajo, pero si se aplica a todas, la cifra ya desafía toda lógica. ¿Logran explicar tal complejidad las hipótesis evolucionistas? ¿Cómo es posible que una serie de accidentes, sucesos aleatorios sin finalidad alguna, hayan dado origen a sistemas interrelacionados de forma tan compleja? Los seres vivos presentan un sinnúmero de características que indican previsión y planificación, lo que a su vez implica la existencia de un Planificador inteligente.
    Muchos especialistas han llegado a esa conclusión. Por ejemplo, el matemático William A. Dembski escribió que el “diseño inteligente” que se manifiesta en determinados “aspectos observables del mundo natural […] solo puede explicarse adecuadamente recurriendo a causas inteligentes”. Michael Behe, bioquímico molecular, resume así la situación: “Es posible ser buen católico y creer en el darwinismo. Sin embargo, a consecuencia de la bioquímica, es cada vez más difícil ser un científico serio y aceptar dicha hipótesis”.
    Todo lo anterior es una muestra mínima del cúmulo de preguntas que quedan sin respuesta si se desestiman las pruebas de que existe un Creador. Algunos científicos comprenden que rechazar a Dios no es una senda fundada en hechos demostrados y lógica cuidadosa, sino en conjeturas aventuradas.
    Tras una vida coronada de éxitos en sus investigaciones y labores en el campo de la astronomía, Allan Sandage dijo: “Fueron mis conocimientos científicos los que me llevaron a concluir que el mundo presenta complicaciones mucho mayores que las que logra esclarecer la ciencia. Solo puedo entender el misterio de la existencia recurriendo al elemento sobrenatur
    Norma

  288. Norma says:

    Hay un dicho que dice:
    Dime de que te jactas o presumes y te diré de que careces.
    Norma.

  289. Walter says:

    Hola Norma:
    Disculpa que no te haya respondido antes, recién veo tus mensajes. Si aún deseas debatir estos temas estoy a tus órdenes.
    Te agradecería también que mencionaras la autoría de los diversos artículos que has copiado sin mencionar el autor ni la fuente. Por ejemplo, encontré una repetida entrada tuya que inicia con “ADN Chatarra” y es un artículo copiado de un tal “cronista Alberto Jarvey” en “Comentaperu.com”, pero allí no aparecen las calificaciones en biología evolutiva del autor.
    Suele ocurrir que neófitos en la materia se explayen mucho en temas que no dominan partiendo de verdades a medias. Tal parece ser el caso del artículo que tu trascribes, pues el objetivo claro del mismo es echar por tierra cualquier análisis científico y saltar hacia la creencia esotérica de un “diseñador inteligente”.
    Eso no es serio. Si quieres postular un diseñador inteligente dinos primero quién diseño al diseñador.
    Saludos
    Walter
    Walter

  290. Norma says:

    Walter: Francamente, no me gusta debatir nada, solamente me intereso en explicar mis puntos de vista y escuchar lo de otras personas como los de este foro y algunos más.
    Que por cierto como casi todas las cosas, algunos son muy buenos y otros no, lamentablemente los creacionistas no aportan mucho con raras excepciones, pues hay
    quienes hacen razonables planteamientos y otros no; sin embargo veo que tres hombres que no creen en Dios defienden sus puntos de vista contra un sin numero increible de supuestos llamados creyentes y prevalecen hasta cierto grado.
    Con relación a ¿Quién diseñó al diseñador? Para mi es un poco complejo, pues en realidad soy un poco neófita en cuanto a esto, pues hay muchas contradicciones antagónicas entre físicos, filósofos, teólogos, etc., Por ej. Para mi, el que diseñó al diseñador a existido siempre, yo entiendo que nadie en su sano juicio pueda decir donde comienza el tiempo y donde termina y donde comienza el espacio y donde termina, entonces me pongo a leer física y hay quien dice que en física quántica, sin entrar en detalles, de la nada pueda surgir algo, y eso me confunde hasta cierto grado, pues en primer lugar es teoría, por lo tanto no es probado y en los laboratorios en cuanto a esto no hay una evidencia concreta como se necesitaría probar en un juicio o tribunal.
    Por otro lado eso de agregar ceros a la derecha sin ninguna limitación es ridículo, da la impresión que cuando uno no puede probar algo, por ejemplo la evolución, entonces dicen: En tantos miles de millones de años (ahí van números a la derecha) se puede probar. ¿Quién va a decir lo contrario? En verdad, es ridículo. La explicación que algunos dan desde la óptica matemática de que un numero que no recuerdo, digamos x elevado a no se que potencia (llamado y) da como resultado no se que Mega número y aparece la vida, mi razonamiento no llega hasta allí, pero si así fuera se necesitaría una fuerza exterior directriz, que yo no recuerdo como le llaman los físicos matemáticos para que esto sucediera y se necesitaría una energía en acción para que esto fuera posible, y si algo manifiesta inteligencia, ¿entonces que hay detrás de la inteligencia? De hecho según los matemáticos si (x) elevado a la potencia (y) da ese numero extraordinario, para ellos es improbable que esto suceda, por no decir imposible en el lenguaje científico. La Ecuación de Albert Einstein es bastante significativa en cuanto a esto, especialmente en lo que se refiere a la energía, y según lo poco que he leído, la energía es eterna y coexiste con el espacio y el tiempo.
    Regresando a lo que estamos tratando con palabras sencillas y fáciles de entender al menos en lo mejor posible, existe en teoría o algo ya se ha probado en los aceleradores de partículas atómicas, que cuando se aceleran átomos a la velocidad máxima, hay un momento en que chocan produciéndose una liberación de energía y a la misma vez se han detectado partículas de antimateria y eso llega a especulaciones de ¿Qué si habría mundos paralelos existiendo a la vez o quizás universos? Desde luego, ¿Cómo podría ser esto sin que hubiera una gran explosión atómica como se vaticina por algunos astrónomos, (En el universo conocido), claro para que esto sucediera debía de haber algún “catalizador” que permitiera que esto fuera posible. (Catalizador del que actualmente no se sabe nada, que yo sepa hasta este momento). Si esta conjetura fuera entonces verdad, ¿se podría decir que posiblemente existen otros “mundos” u otros universos, para no mencionar lo dimensional, muy bien pudieran ser x-mensionales? No sé que respuesta pudiera darle a esta cuestión. De hecho ser un ateo conservador en este macrocosmo universo, donde no conocemos ni lo alto, ni lo profundo, ni lo ancho del mismo y que nosotros somos menos que una molécula en el planeta, que por cierto, es un planeta muy peculiar, es como como tirar golpes al aire. Me parece con todo el respeto que es mejor ser un agnóstico. Aparte de todo, durante los últimos cinco años la genética ha avanzado tanto, especialmente en cuanto al DNA o ADN se refiere y la balanza se inclina hacia el lado creacionista. N

  291. Walter says:

    Hola Norma:
    La pregunta “¿Quién diseñó al diseñador”? Es solo retórica y sirve para demostrar la invalidez del argumento de que “para que algo exista debió ser diseñado por alguien”; si eso fuera así y “Dios existe”, también “debió ser diseñado” o creado por alguien más, con lo cual entras en una regresión infinita. Por lo tanto la premisa de que “la existencia requiere diseñador” es falsa, para que Dios exista no es necesario que lo hayan diseñado. Entonces, si Él pudo existir sin que nadie lo diseñe o lo cree, ¿Por qué no pudo hacerlo el Universo?
    Claro que pueden decir que Dios existe desde siempre y es el creador de todo; pero en eso no hay argumento racional, lo creen porque quieren creerlo y no porque sea lógico.
    Veamos ahora lo que llamas “contradicción” entre Física, Filosofía y Teología. Parece que te confunden porque no sabes a cuál de ellas creerle. Pues bien, vamos a ver cual de ellas es más creíble; cuál ofrece una visión más sólida y confiable, más veraz. Debes tener en cuenta primero que lo que llamamos verdad es aquello que consideramos como tal en virtud del consenso de la humanidad. Entonces ¿Cual de esas tres ramas del conocimiento tiene el mayor consenso, la mayor veracidad, la mayor credibilidad?
    La Física es una rama de la Ciencia que ha permitido demostrar que el espacio y el tiempo, son aspectos de una misma cosa y que empezó a existir hace unos quince mil millones de años. Eso es lo que se estudia en todas las universidades del mundo y lo que es aceptado por el consenso de la comunidad científica.
    La Filosofía es una rama del conocimiento que se ocupa del significado de las cosas mediante el uso del razonamiento lógico, no pretende explicar cuando se inició el Universo, sin más bien cual es su sentido. Como es una concepción abstracta y especulativa, hay diferentes enfoques filosóficos con más o menos igual validez pues por lo general se trata de temas tan abstractos y especulativos que difícilmente se puede demostrar que no sea así. Por ejemplo hay idealistas y materialistas. Unos creen que existe un espíritu inmaterial que dirige y sobrevive al cuerpo material, y los otros que solo existe el cuerpo material. No hay consenso entre ellos, cada quién cree que tiene su verdad.
    La Teología es un conjunto de técnicas con la que se pretende alcanzar el conocimiento de dioses y otros entes sobrenaturales. Como en este caso ya no se utiliza el razonamiento lógico, sino la sola creencia en escritos y dogmas, es natural que existan diferentes teologías dedicadas a muchos dioses, y que cada una de ellas sostenga cosas diametralmente opuestas a las de los demás. No se requier probar nada, solo creer, y cada quien puede creer lo que quiera.
    Entonces, más que “contradicción” diría yo que es un asunto de confusión, hay un abismo de diferencia entre el conocimiento y la creencia religiosa.
    Es cierto que la ciencia sostiene que antes del Bigbang no existían el tiempo ni el espacio, pero eso no quiere decir que no existía nada; y no es cierto que la física cuántica afirme que “de la nada puede surgir algo”, no es así. La ciencia no habla de la “nada”, eso es un concepto filosófico, la ciencia habla del “vacío cuántico”, que es un concepto físico, y el hecho que de él surjan partículas no es una teoría, es una comprobación experimental.
    Si te molestan los ceros a la derecha puedes usar la notación científica y reemplazar las cifras muy extensas por unos pocos dígitos multiplicados por 10 elevado a la n potencia, siendo n el número de dígitos la derecha. Por ejemplo 5’000’000’000’000 seria 5×10^12, y se acabó el problema. Y no importa si detrás del 5 hay ceros o números, en esas magnitudes se puede redondear sin variar mucho la cifra global.
    Ahora si lo que quieres decir es que el espacio y el tiempo “tienen que ser más pequeños” para que puedas entenderlo, lamentablemente no es así. Las magnitudes del Universo y el tiempo son increíblemente gigantescas tanto en lo más grande como en lo más pequeño, pero así es la naturaleza, no es cuestión de gustos sino lo que el ser humano ha ido descubriendo tras siglos de estudios. Es solo una cuestión de conocimientos.
    Tu pregunta ¿Qué hay detrás de la inteligencia? Tiene una respuesta muy simple: El cerebro y la sociedad. Para que funcione el cerebro hay que alimentarlo con la información que hay en la sociedad, y acostumbrarlo a razonar para distinguir lo verdadero de lo falso, y a sacar conclusiones.
    La energía y la materia son aspectos de la misma cosa y la primera ley de la termodinámica o principio de la conservación de la energía, que es a lo que aludiste, se resume como: “la energía no puede crearse ni destruirse, sólo se puede cambiar de una forma a otra” (wiki) Esa regla nunca se ha roto; todos los experimentos con aceleradores de partículas, incluyendo el propio descubrimiento de la antimateria, confirman el principio de conservación de la energía.
    Lo de los mundos o universos paralelos solo es especulación, no me parece correcto sacar conclusiones partiendo solo la imaginación, eso lo hace la teología, y no hay que confundir conocimiento científico con mitología especulativa.
    En cuanto a que nuestra pequeñez en el cosmos o nuestra ignorancia sobre muchos aspectos de éste, descalifiquen una posición atea, no me parece. Por el contrario, el conocimiento del cosmos y de nuestra posición dentro de él solo son coherentes con una posición atea. El agnosticismo es creer en medio dios. Yo no creo que exista nada sobrenatural, mucho menos un dios personal como lo pintan algunas religiones contemporáneas.
    Tu afirmación de que los avances en genética inclinan la “balanza” supongo que te refieres a la balanza de tus simpatías ideológicas, que la inclina digo hacia el creacionismo. Bueno, eso me parece una afirmación sumamente descabellada y totalmente patas arriba. La genética ha demostrado que todos los seres vivos hemos evolucionado partiendo de un ancestro común. Los creacionistas sostienen que Dios hizo a todas las especies por separado y que no hay parentesco alguno entre ellas, especialmente del hombre creado a imagen de dios con los animales que son seres inferiores creados para servir al hombre.
    Justo estoy leyendo un libro que se llama “Matemáticas ¿Estas ahí” de Adrián Paenza, y menciona este punto de los avances de la genética, y dice:
    “El texto que sigue muestra cómo los vasos comunicantes que generaron biólogos y matemáticos que trabajan en la frontera del conocimiento, permitieron poner en evidencia (una vez más) la existencia de ancestros comunes. …. Desde el momento en que, en el 2003, se completó el Proyecto Genoma Humano comenzó también la carrera por conocer e identificar a nuestros antepasados, y saber con quiénes compartimos ese “privilegio”. El proyecto, que duró más de trece años, permitió identificar los (aproximadamente) entre 20.000 y 25.000 genes del genoma humano, y determinar las secuencias de los 3.000 millones de pares de bases químicas que lo componen. El ADN de una persona es algo así como su cédula de identidad.
    Ahí está escrita toda la información necesaria para el funcionamiento de sus células y sus órganos. En esencia, en una molécula de ADN está inscripto todo lo que podemos ser, nuestras particulares aptitudes y capacidades, y algunas de las enfermedades que podemos padecer. No obstante, es la combinación de esa información con el aporte del ambiente lo que hace que cada uno de nosotros sea único. Esa doble hélice es una especie de serpentina que tiene escritas dos tiras enfrentadas de largas cadenas de esas cuatro letras. Miren esta porción de ADN: TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG Son 42 letras, en el orden en el que están escritas.
    Para decirlo de otra manera, sería como una palabra de 42 letras. Esta “tira” del genoma fue encontrada (después de un arduo trabajo matemático y computacional de “alineación” de las distintas secuencias) en algún lugar del ADN de los siguientes vertebrados: hombre, chimpancé, ratón, rata, perro, pollo, rana, peces… Si uno tirara un dado, que en lugar de tener las seis caras convencionales, tuviera sólo cuatro lados, rotulados A, C, G, T, la probabilidad estimada de que esta secuencia de 42 letras apareciera en ese orden es de 1 dividido por 1050. Es decir, la probabilidad de que esto haya ocurrido por azar es aproximadamente igual a: 10^-50 = 0,00000…0001.
    Para decirlo de otro modo, el número empezaría con un cero, luego de la coma habría cincuenta ceros, y sólo entonces un número uno.
    Justamente, la probabilidad de que esto ocurra es tan baja que permite a los autores del artículo conjeturar que todos ellos tuvieron un antepasado o un ancestro común (probablemente hace unos quinientos millones de años), que ya poseía esa secuencia de 42 bases, que fue heredada intacta a todos los descendientes de las distintas ramas de vertebrados. Por lo tanto, si bien uno no puede hablar de certeza, la probabilidad de que el hombre tenga el mismo origen que un pollo, o un perro, o un ratón (ni hablar de un chimpancé), es altísima.
    Fin de la cita.
    Saludos
    Walter
    PD: Me encantaron todos los tópicos que tocaste, en cuanto al de Mecánica Cuántica si te interesa puedes descargar gratuitamente de Internet un excelente libro sobre el tema de Crehuet y Artus. Es mejor guiarse sobre asuntos de ciencia leyendo a los especialistas. Mucha gente habla de cosas que no sabe, en particular los apologistas cristianos que distorsionan la biología y la física para que disfrace de modernidad sus infantiles creencias medievales.

  292. Norma says:

    Hola Walter: Primero que todo, gracias por tus atinadas respuestas, estoy de acuerdo en muchos de tus comentarios, aunque francamente no entiendo bien algunas de tus afirmaciones o puntos de vista en cuanto a los diferentes temas que hemos comentado muy agroso modo.
    Me parece que asi es como deberian las personas analizar los diferentes puntos de vista aunque no coincidan unos de otros, pues atacandose y hasta ofendiendose no se saca provecho de nada, por lo tanto te felicito por tan buena explicacion dada, repito, como ya dije al principio. Hoy no tengo mucho tiempo para estar en el ordenador, pues hay problemas de salud en la familia, pero en otra ocasion, pienso escribir mas amplia y detalladamente; por cierto me prestaron un libro de arqueologia que trata del arca del dia de Noe y está fascinante, es una traduccion del ingles al castellano, me gustaria tratar algo de este tema en un futuro no muy lejano.
    Saludos
    Norma

  293. Walter says:

    Hola Norma:
    Espero que todo se mejore para tí.
    En cuanto a que un libro de Arqueología trate sobre el Arca de Noe lo dudo mucho. La arqueología trata de evidencias materiales de sociedades que existieron en el pasado, y el Arca de Noe solo es un cuento mitológico, bastante infantil y absurdo, por cierto.
    Lo que ocurre es que los apologístas bíblicos se inventaron una seudo ciencia llamda “arqueología bíblica” que se ocupa de demostrar que la biblia dice la verdad literal.
    En este caso quieren presentar como prueba de la existencia del Arca de Noe una foto aérea de una sombra sobre una montaña de Turquía, que ellos interpretaron como la imagen de un barco.
    Aunque no lo creas, sobre esa deleznable base han llevado a cabo numerosas expediciones y han escrito muchos libros especulativos, pero nunca han encontrado ninguna evidencia material.
    Saludos
    Walter

  294. yop says:

    ¿sabeis que os digo?
    — ME CAGO EN DIOS —
    Total no existe, asi lo demuestran las calamidades que se ven por la tele todos los dias, vease “niños de africa muriendo de hambre”.

  295. Juanito says:

    Hola:
    Quisiera que alguien tuviera el favor de explicarme como si yo fuera un niño de doce años, ?Donde comienzan el espacio y el tiempo y donde terminan? Gracias por adelantado. No quiero teorias ni especulaciones, quiero evidencias.
    Juanito

  296. Walter says:

    Hola Juanito:
    Para comprender cuando empezó el tiempo y el espacio tienes que estudiar física a un nivel un poco mayor del que estudia normalmente un niño de doce años.
    Para que te des una idea, Wikipedia dice:
    “Basándose en medidas de la expansión del Universo utilizando observaciones de las supernovas tipo 1a, en función de la variación de la temperatura en diferentes escalas en la radiación de fondo de microondas y en función de la correlación de las galaxias, la edad del Universo es de aproximadamente 13,7 ± 0,2 miles de millones de años. Es notable el hecho de que tres mediciones independientes sean consistentes, por lo que se consideran una fuerte evidencia del llamado modelo de concordancia que describe la naturaleza detallada del Universo.”
    Debes también tener en cuenta que el tiempo y el espacio son aspectos de una misma cosa.
    “La expresión espacio-tiempo recoge entonces la noción de que el espacio y el tiempo ya no pueden ser consideradas entidades independientes o absolutas.
    Las consecuencias de esta relatividad del tiempo han tenido diversas comprobaciones experimentales. Una de ellas se realizó utilizando dos relojes atómicos de elevada precisión, inicialmente sincronizados, uno de los cuales se mantuvo fijo mientras que el otro fue transportado en un avión. Al regresar del viaje se constató que mostraban una leve diferencia de 184 nanosegundos, habiendo transcurrido “el tiempo” más lentamente para el reloj en movimiento”
    Ahora, en cuanto a cuando terminara el tiempo y se acabará el espacio, hay varias teorías aún en estudio.
    “El destino último del Universo es un tema en cosmología física. Las teorías científicas rivales predicen si el Universo tendrá duración finita o infinita. Una vez que la noción de que el Universo empezó con el Big Bang se hizo popular entre los científicos, el destino final del Universo se convirtió en una pregunta cosmológica válida, dependiendo de la densidad media del Universo y la tasa de expansión.
    El Universo está actualmente en expansión. Sin embargo, las mediciones que Allan R. Sandage realizó en los años 1960 con su telescopio de 200 pulgadas muestran que el ritmo de expansión actual es menor que el de hace 1.000 millones de años. Este hecho puede implicar o no que la expansión se detenga, planteándose dos alternativas para el destino último del Universo.
    Según las teorías cosmológicas actuales, la cantidad de materia que hay en el Universo es la que decidirá el futuro del mismo. Se tiene una idea bastante aproximada de la cantidad de materia visible que existe, pero no de la cantidad de materia oscura, dependiendo entonces de ésta el futuro del Universo.
    Se ha podido calcular que si la densidad del Universo es menor que tres átomos por metro cúbico, será insuficiente para frenar la expansión, el Universo se expandirá indefinidamente (Big Rip) y será condenado a una muerte fría en medio de la oscuridad más absoluta. En este caso el tiempo se acabaría en unos 35.000 millones de años. Pero si la masa es suficiente para detener la expansión, tendrá lugar el Big Crunch o, lo que es lo mismo, el Universo, forzado por la gran cantidad de masa, empezaría a comprimirse hasta que, dentro de unos 20.000 millones de años, acabe por colapsarse en una singularidad, algo parecido al Big Bang, pero al revés. En este caso tras el Big Crunch es posible que el Universo comience de nuevo con otro (o, según el modelo cíclico, el mismo) Big Bang.”
    Saludos,
    Walter

  297. Juan says:

    Hola: Walter.
    Pero sigue siendo teoria, no hay evidencia concreta de cuando comienza el tiempo y el espacio y cuando terminan. Teorias y mas teorias, pues no son mas que especulaciones. Cuando alguien lo sepa, por favor me responde como a un niño de doce años (expresion que ya saben lo que significa, no tengo que explicarlo…) Bye. Juanito.

  298. Walter says:

    (Reenvio un poco modificado el mensaje que pasé ayer y aún no aparece en esta entrada)
    Hola Juanito:
    Las teorías científicas no son “especulaciones” ni “solo teorías”; si revisas el diccionario de la Real Academia verás que el término teoría tiene varias acepciones y que tu utilizas la acepción errada:
    Teoría:
    “1. Conocimiento especulativo considerado con independencia de toda aplicación.” Que es la que tú le atribuyes, y;
    “3. Hipótesis cuyas consecuencias se aplican a toda una ciencia o a parte muy importante de ella.” Que es la que corresponde a las teorías científicas.
    ¿Ciencia o especulación?
    La teoría del Bigbang es una teoría científica similar a la teoría de la Gravitación Universal, a la teoría de la Estructura del ADN, a la teoría de la Evolución, a la teoría de la Relatividad, a la teoría de la Estructura Atómica de la Materia, a la teoría Microbiana de la Enfermedad, etc.
    Coincidirás conmigo en que resulta temerario decir, por ejemplo, que la teoría de la Relatividad “es solo una teoría”, por más que muchas de sus evidencias sean bastante más difíciles de comprender para los legos en la materia, que las evidencias del Bigbang.
    Evidencias
    Las evidencias que le niegas al Bigbang están explicadas en el artículo que puse de la enciclopedia pero como parece que no las tomas en cuenta, trataré de explicar la principal de ellas de la forma más sencilla posible:
    El Universo se expande
    Puedes comprobar que cuando un tren se acerca el sonido que emite su silbato es agudo y cuando se aleja es grave. Pues bien, eso se debe a que las ondas del sonido se comprimen al acercarse a uno, volviéndose más agudas, y se ensanchan al alejarse, volviéndose más graves.
    Eso mismo ocurre con la luz, cuando se acerca a nosotros un foco luminoso las ondas se comprimen y el color se desplaza hacia el azul, de menor longitud de onda; y cuando se aleja las ondas se expanden y el color se corre hacia el rojo, de mayor longitud de onda.
    Resulta que por los años 30 del siglo pasado los astronomos observaron que la luz de TODAS las galaxias presentaba un marcado corrimiento hacia el rojo, más intenso mientras mas lejos estaban. Ese fenómeno solo podía explicarse asumiendo que todas las galaxias se alejaban unas de otras y a una velocidad mayor mientras más lejos estaban. Las observaciones y mediciones del último siglo han confirmado y aportado abundantes pruebas de que todas las galaxias se están alejando unas de otras, es un hecho comprobado que el Universo se expande.
    Ahora bien, si las galaxias se alejan unas de otras quiere decir que antes estaban más cerca. ¿Cuánto más cerca? Como se conoce la velocidad a la que se alejan los científicos han calculado que cerca de 14,000 millones de años atrás todas se encontraban en el mismo punto, a partir del cual empezaron a separarse. El inicio de esa separación es lo que se denomina Bigbang.
    Verifiqué que esa explicación la puede entender un niño de 12 años, hice la prueba con un sobrino mío y quedó encantado.
    Entonces Juan, en aras de la equidad te pediría ahora que me expliques cuál es tu idea del origen del universo y cuáles son las evidencias en que basas tu teoría.
    Saludos
    Walter

  299. Alguien says:

    Yo simplemente creo que si los demás creen en algo o en Alguien, eso debe ser respetado. El hecho de atacar las creencias profundas de las personas, es algo repudiable. El ser humano ha llegado a la frialdad tal que el egoísmo y el “placer” ha infundido su vida. Todos buscamos simplemente “sentirnos” bien. Y si el autor de este teatro se “sintió bien” burlándose de las creencias de los demás, discúlpenme, creo que es un idiota. No hablaría mal de ninguna religión, sea como sea, hay que respetar. Tampoco justifico el acto de quemar el lugar, pero ponganse en el lugar de aquellos creyentes en Dios. Por favor, hay cristianos que creen muy firmemente en Dios, y es como si insultaran a algo más que a su madre. ¿Qué diría dicho autor o el actor si aparece una obra diciendo: Me cago en la madre de Fernando Incera ?
    Seamos conscientes, veamos que ninguna forma de agresión es correcta, y en eso coincido con los cristianos, aunque en esta se pasaron. Prediquemos pues, la moral y las buenas costumbres, y no seamos bobitos, cagándonos los unos a los otros. Por eso este mundo está cagado.

  300. Juanito says:

    Hola: Walter.
    Antes que escribiera el que se hace llamar “alguien”,
    yo te conteste, creo al mi parecer con mucho respeto y decencia, sin embargo no fue aprobado. Esto no me sucede la primera vez; ya ha ocurrido otras veces. Estoy buscando otro blog para tratar con personas lo mas imparciales posible acerca de la existencia de Dios, pero sino publican algo porque no les conviene o lo que sea ?Como se llama eso? Quiero contactar con personas creyentes, pero no asociadas a ninguna religion, pues quiero tratar el tema de ?Quien creo a Dios? y para los creyentes ?Por que creo Dios? Un saludo muy respetuoso. J.

  301. Walter says:

    ANTOLOGÍA DE LOS TÓPICOS MÁS TONTOS
    En estas semanas veraniegas, voy a hacer una breve antología de esas frases bobas, estúpidas o indignas que funcionan como dogmas de fe. Parecen tan evidentes que no nos molestamos en analizarlas. La que comento es una de ellas. Cuando digo a mis alumnos que no es verdad que todas las opiniones sean respetables me miran como si estuviera atentando contra los Derechos Humanos, o algo así. Pero no es verdad. Lo que la Ética y el Derecho defienden es que nadie pueda ser perseguido, encarcelado o asesinado por sus opiniones. Es decir, lo que se protege, lo que es respetable, es la persona que opina, no el contenido de sus opiniones. Estas pueden ser falsas, injustas, peligrosas, brutales, perversas, asesinas ¿Cómo vamos a respetarlas? Imagine el lector que el profesor de matemáticas de su hijo le enseñara que dos más dos son cinco, y que, al protestar usted, le contestara que debía respetar sus opiniones aunque no las compartiera. Cada opinión tiene su criterio de respetabilidad. Si se trata de matemáticas, su criterio es matemático. Si se habla de ciencia, es científico. Si se habla de política es la justicia. El derecho a la libertad de opinión tiene un deber correlativo: el deber de buscar la verdad, de escuchar los argumentos, y de rendirse a las evidencias más fuertes. De lo contrario, la libertad de creencias puede convertirse en protectora de los bestias.
    José Antonio Marina/ Filósofo (Diario El Mundo, 14 de julio de 2002

  302. Walter says:

    Hola Juanito:
    Es probable que tu mensaje no haya aparecido por algún error técnico. Me ha pasado varias veces, fíjate nomás que más arriba menciono que publiqué nuevamente mi comentario porque no había salido el anterior. Intenta nuevamente. Me parece que no se publican los mensajes cuando los enviamos desde la página de vista previa.
    Lamento que no hayas tocado el tema del Bigbang; pensé que realmente querías conversar sobre ese asunto y no sobre seres imaginarios.
    Walter

  303. Libertad says:

    estreno de la nueva obra
    “ME CAGO EN LOS MUERTOS DE LA REPÚBLICA”
    Bueno, tengo que ser respetado, ya que la república Española no exixte, y es mi libertad de espresión realizar la obra que considere oportuna ¿no?
    Ahora me diran que eso si que no lo puedo decir porque la república tiene muertos¿y los católicos no tienen muertos?
    Todos losque puedan empezar a criticarme o que respondan tramas filosoficas alucinantes dando mil argumentos e historias para no dormir, de antemano, me parecen innecesarias, puesto que todos los que os perecie bien la obra de ME CAGO EN DIOS q la defendeis como libertad de espresión, os pareceria mal que yo realizara mi obra burlandome libremente de loque me de la gana? soy libre y divagad con losque os parezca, pero es lo mismo e igual de ofensivo para quien se quiera dar por aludido. Esque a mi abuelo lo mataron por republicano… y a mi tio abuelo por llamarse JUan de Dios…
    Asique decid loque querais, ya veo que mas de uno empezara a decir cualquier cosa, para decir que mi opinión es mala y cagarse en Dios es libertad.
    y a losque os tengais que morder la lengua y reconocer que soy libre de opinar loque quiera¿como os sentis?¿no es divertido que me meta con cosas que os duelen?
    Pes que la proxima vez que alguien publique su opinion , espero que sea consecuente con losque no piensan igual.
    P.D:Juanito si yo me cago en tu madre te ofendes? y no me vengas con que tu madre es real y Dios no, porque si te ofendes, yo tambien, porque no me vengas con chorradas de esas, vas a juzgar tu los sentimientos de los cristianos tienen en Dios, porque ami me ofende muxo más que se cagen en Dios que en mi madre, muchas personas murieron y estan muriendo por Dios, y si tu eres quien para decir q no es lo mismo, porq a TU PARECER Dios no es real y me puedo cagar en él, yo me cago en los muertos de la república no? y ahora di loque quieras justificandote y llamandome de todo que es tu oficio, pero si te ofende q me meta con tu madre dentro de mi libertad, no me digas q no me puedo ofender porq se caguen en Dios, y si estamos deacuerdo, seamos consecuentes. si eres libre de cagarte en Dios puedo cagarme en todo loq me de la gana en los muertos de quien me de la gana y en la madre de quien me de la gana, y si no puedo,cagarme en todo, del mismo modo no se pueden cagar,sin ofender, en DIOS. muchas gracias y difana loque quieras.

  304. libertad says:

    juenito, siento referirme a ti, pero podria ser juanja o el walter ese, que todos se creen portadores de la libertad y la justicia, pero pocos realmente la imparten por igual. lo dicho, se metan y divaguen lo que quieran, mi opinion ya está espresada y que se metan conmigo y intenten destruir mis argumentos, soy libre y me cago en loque me da la gana,
    ME CAGO EN LOS MUERTOS DE LA REPÚBLICA, y si no puedo… pues que no se caguen en DIOS.asi de simple,,, pero ya veras como intentan decir q si pero no, no pero si, q la conclusión sera que ellos pueden y yo no…. libertad solo para ellos.

  305. Cibercoya says:

    Junjan:
    Considera que tierra eres y en tierra te has de convertir.
    Día llegará en que has de morir y pudrirte en una fosa, donde estarás cubierto de gusanos. A todos, nobles o plebeyos, príncipes o vasallos, ha dé tocar la misma suerte. Apenas, con el último suspiro, salga el alma del cuerpo, pasará a la eternidad, y el cuerpo, luego, se reducirá a polvo.
    Imagínate en presencia de una persona que acaba de expirar: Mira aquel cadáver, tendido aún en su lecho mortuorio; la cabeza inclinada sobre el pecho; esparcido el cabello, todavía bañado con el sudor de la muerte; hundidos los ojos; desencajadas las mejillas; el rostro de color de ceniza; los labios y la lengua de color de plomo; yerto y pesado el cuerpo… ¡Tiembla y palidece quien lo ve!… ¡Cuántos, sólo por haber contemplado a un pariente o amigo muerto, han mudado de vida y abandonado el
    mundo!
    Pero todavía inspira el cadáver horror más intenso cuando comienza a descomponerse… Ni un día ha pasado desde que murió aquel joven, y ya se percibe un hedor insoportable. Hay que abrir las ventanas, y quemar perfumes, y procurar que pronto lleven al difunto a la iglesia o al cementerio, y que le entierren en seguida, para que no inficione toda la casa… Y el que haya sido aquel cuerpo de un noble o un potentado no servirá, acaso, sino para que despida más insufrible fetidez, dice un autor.
    «Ved en lo que ha venido a parar aquel hombre soberbio, aquel deshonesto!… Poco ha, veíase acogido y agasajado en el trato de la sociedad; ahora es horror y espanto de quien le mira. Apresúranse los parientes a arrojarle de casa, y pagan portadores para que, encerrado en su ataúd, se lo lleven y den sepultura… Pregonaba la fama no ha mucho el talento, la finura, la cortesía y gracia de ese hombre; mas a poco de haber muerto, ni aun su
    recuerdo se conserva.
    «Al oír la nueva de su muerte, limítanse unos a decir que era un hombre honrado; otros, que ha dejado a su familia con grandes riquezas. Contrístame algunos, porque la vida del que murió les era provechosa; alégranse otros, porque esa muerte puede serles útil.
    «Por fin, al poco tiempo, nadie habla ya de él, y hasta sus deudos más allegados no quieren que de él se les hable, por no renovar el dolor. En las visitas de duelo se trata de otras cosas; y si alguien se atreve a mencionar al muerto, no falta un pariente que diga: “¡Por caridad, no me lo nombréis más!”».
    Considera que lo que has hecho en la muerte de tus deudos y amigos así se hará en la tuya. Entran los vivos en la escena del mundo a representar su papel y a recoger la hacienda y ocupar el puesto de los que mueren; pero el aprecio y memoria de éstos poco o nada duran.
    Aflígense al principio los parientes algunos días, mas en breve se consuelan por la herencia que hayan obtenido, y muy luego parece como que su muerte los regocija. En aquella misma casa donde hayas exhalado el último suspiro, y donde Jesucristo te habrá juzgado, pronto se celebrarán, como antes, banquetes y bailes, fiestas y juegos… ¿Y tu alma? ¿dónde estará entonces tu alma?
    * * * * * * *
    Desde San SAlvador de Jujuy, Argentina, un viril abrazo a la Madre Patria.

  306. clalliesaum says:

    Hey whats up yo, been reading here for a while and decided to write. Something’s just spinning around in my head lol.
    [url=http://frugal-admin.blogspot.com/2011/02/openvz-deals.html]Wow I saw a VPS for less than $5[/url]
    So I was reading an article today and my eyes strayed towards an ad for a VPS server going for $4.95 per month. Now take into account this wasn’t shared hosting which I have seen as well for around $1 per month in various places but a full blown Virtual Private Server. It got me thinking whether or not it’s going to be worth it to buy shared hosting today when you can just grab a VPS instead.

  307. sexiaclielm says:

    hello you essential look into this [url=http://www.w-polsce-mamymocne-seo.pl]wpolscemamymocneseo[/url]

  308. [url=http://www.ps3jailbreaking.com]PS3 Jailbreak[/url]

  309. In my life I watched the thousands, nay – tens of thousands of different websites. Today I have no doubt that it is difficult to get a really good blog. Usually this type of sites dealing with children who rely on free scripts, free servers, and write to all of this do not know what – even the same can not say why these blogs are. Therefore, with a large dose of skepticism is always approached for this kind of web sites and always willing to write on any kind of forums about their fears

  310. In my life I watched the thousands, nay – tens of thousands of different websites.

  311. In my life I watched the thousands, nay – tens of thousands of different websites.

  312. In my life I watched the thousands, nay – tens of thousands of different websites.

Comenta ya maldit@!